Overview

Distribution

circum-(sub)tropical
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Warm temperate and tropical seas around the world.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The maximum length of shell is 30 cm in females, but only 1.5-2 cm in males. The shell is coiled and laterally compressed with a narrow keel and numerous sharp nodules. Nodules toward the center of the coil are brown, but most of the shell is white.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Mantle globular, as wide as long; surface of mantle, head, arms, and web covered with conspicuous, closely-set, large, stellate tubercles; a narrow, tuberculate, fold of skin encircles the lateral surface of the mantle; funnel organ, 4 separate longitudinal pads.
  • Roper, C.F.E., M.J. Sweeney & C.E. Nauen (1984). FAO Species catalogue. Vol 3. Cephalopods of the World. An annotated and illustrated catalogue of species of interest to fisheries. FAO Fish. Synop. (125), Vol 3: 277 p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

epipelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Likes to be near the surface of the water. It is an epipelagic oceanic species.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 62 specimens in 2 taxa.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 18 - 4935
  Temperature range (°C): 2.203 - 27.746
  Nitrate (umol/L): 0.065 - 22.031
  Salinity (PPS): 34.193 - 39.011
  Oxygen (ml/l): 3.016 - 6.187
  Phosphate (umol/l): 0.027 - 1.426
  Silicate (umol/l): 0.801 - 42.909

Graphical representation

Depth range (m): 18 - 4935

Temperature range (°C): 2.203 - 27.746

Nitrate (umol/L): 0.065 - 22.031

Salinity (PPS): 34.193 - 39.011

Oxygen (ml/l): 3.016 - 6.187

Phosphate (umol/l): 0.027 - 1.426

Silicate (umol/l): 0.801 - 42.909
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Feeds on plankton and small organisms on the surface of the water.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The male uses a specialized arm called a 'hectocotylus' to fertilize the eggs. The hectocotylus is inserted into the females pouch and breaks off during mating. The female forms a "nacelle," a thin calcareous shell, with two of her legs (the others are used for swimming). This structure holds the eggs throughout development.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Argonauta argo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTTATTTTTGGTATTTGATCAGGTCTTTTAGGTACATCATTAAGTCTAATAATTCGAGCAGAACTTGGACAACCTGGATCCCTTTTAAATGAT---GATCAATTATATAATGTTATTGTAACAGCCCATGCTTTTGTAATAATTTTTTTTTTAGTTATACCTGTAATAATTGGAGGATTTGGTAACTGACTTGTTCCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGTTTTTGACTTCTTCCTCCTGCTTTAACTCTTCTTTTAGCATCAGCTGCTGTAGAAAGAGGGGTTGGAACTGGGTGAACTGTTTATCCTCCTTTATCAAGAAATCTAGCTCATATAGGTCCTTCCGTTGACTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCGATTCTTGGAGCAATTAACTTTATTACAACCATTGTTAATATACGGTGAGAAGGTATACTTATAGAACGTTTACCTTTATTTGTATGATCTGTTTTAATTACAGCTGTCTTATTACTTTTATCTCTTCCAGTTTTAGCTGGAGCAATTACTATACTATTAACTGACCGAAACTTTAATACAACTTTTTTTGATCCAAGAGGAGGAGGAGACCCTATTTTATATCAACATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Argonauta argo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This animal is very common but is rarely spotted by humans. Every once and a while many of them may be washed up by a change in currents or chased into shallow waters by predators, allowing people to observe and catch them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Can be found in fish markets in India and Japan. The shell is praised by collectors because of its beauty, coloration, sculpture, and fragility.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Argonauta argo

Argonauta argo, also known as the greater argonaut, is a species of pelagic octopus belonging to the genus Argonauta. The female of the species, like all argonauts, creates a paper-thin eggcase that coils around the octopus much like the way a nautilus lives in its shell, hence the name paper nautilus. The Chinese name for this species translates as "white sea-horse's nest".[1] A. argo was the first argonaut species to be described and is consequently the type species of the genus. A. argo is the largest species in the genus and also produces the largest eggcase. Live animals have a characteristic blue sheen on the first arm pair and around the eyes.[1] The eggcase is characterised by two rows of small, sharp tubercles running along a narrow keel, smooth ribs across the walls of the shell, and a thickening along the shell aperture, which forms distinct protrusions or 'horns' on either side.[1] Argonauta cygnus Monterosato, 1889 was described based on a shell which lacked these protrusions, although it is now considered a junior synonym of A. argo. The greatest recorded size of an A. argo eggcase is 300.0 mm.[2][3]

Left: One of the earliest known depictions of A. argo, from Index Testarum Conchyliorum (1742) by Niccolò Gualtieri
Right: A female A. argo without its shell

A. argo is cosmopolitan, occurring in tropical and subtropical waters worldwide.[1] A dwarf form exists in the Mediterranean Sea, which was described as Argonauta argo mediterranea Monterosato, 1914, although this taxon is now regarded as invalid.

A. argo is thought to feed primarily on pelagic molluscs. The species is preyed on by numerous predators. It has been reported in the stomach contents of Alepisaurus ferox from the south-western Pacific.[4]

Males of this species reach sexual maturity at a mantle length (ML) of 8 mm.[5] Females mature at about double the size of Argonauta bottgeri and Argonauta hians.[5] They begin to secrete an eggcase at 6.5–7 mm ML.[5] Eggs are usually laid when females reach 14–15 mm ML, although the size at which this takes place differs across the animal's range.[6] A small A. argo residing in an 88 mm long eggcase was estimated to be carrying 48,800 embryos.[7] Females grow to 100 mm ML, while males do not exceed 20 mm ML.[1]

In the open ocean, A. argo has been observed attached to jellyfish.[8] This behaviour has been known for a long time,[8][9] although little was understood about the relationship prior to the work of Heeger et al. in 1992.[10][11] In "Predation on jellyfish by the cephalopod Argonauta argo", Heeger et al. describe their observations of a female A. argo found atop a host jellyfish. The argonaut was seen holding on to the aboral (exumbrellar) surface of the jellyfish using its lateral and ventral arms. The authors found that about half of the animal's aboral surface was damaged and large pieces of mesoglea were missing, presumably removed by the argonaut. Additionally, two holes, apparently bite marks, were found in the center of this area with channels leading from these holes into the gastral cavity of the jellyfish. The argonaut presumably used these channels to suck food particles from the gastral cavity. Heeger et al. suggested that "the association provided shelter or camouflage for the argonaut".[10][11]

Observations of captive A. argo females suggest that the expanded webs of the dorsal arms may aid the animal in feeding. Mark Norman mentions that "when food was touched against the spread webs, an arm shot out of the shell in a sweeping action, grabbing the prey".[1] It is speculated that argonauts do not actively hunt, but employ this method to catch animals that bump into them in the open ocean.[1]

A. argo is occasionally involved in mass strandings along the South African and southern Australian coastlines. The strandings are seasonal and generally occur between April and August, towards the end of the animals' spawning season.

A damaged beak of a female A. argo (ML = 40.0 mm; caught at 20°56′N 175°33′W / 20.933°N 175.550°W / 20.933; -175.550), measuring 4.30 mm in hood length and 7.80 mm in crest length, is mentioned in A Handbook for the Identification of Cephalopod Beaks.[12]

The type specimen of A. argo was collected in the Mediterranean Sea and is deposited at the Linnean Society of London.[13]

References[edit]

  1. ^ a b c d e f g Norman, M. (2000). Cephalopods: A World Guide. ConchBooks. pp. 190–191. 
  2. ^ Pisor, D. L. (2005). Registry of World Record Size Shells (4th ed.). Snail's Pace Productions and ConchBooks. p. 12. 
  3. ^ (Russian) Nesis, K. N. (1982). Abridged key to the cephalopod mollusks of the world's ocean. Light and Food Industry Publishing House, Moscow, 385+ii pp. [Translated into English by B. S. Levitov, ed. by L. A. Burgess (1987), Cephalopods of the world. T. F. H. Publications, Neptune City, NJ, 351 pp.]
  4. ^ (French) Rancurel, P. (1970). "Les contenus stomacaux d' Alepisaurus ferox dans le sud-ouest Pacifique (Céphalopodes)". Cah. O.R.S.T.O.M. Ser. Océanogr. 8 (4): 4–87. 
  5. ^ a b c (German) Naef, A. (1923). "Die Cephalopoden, Systematik". Fauna Flora Golf. Napoli (35) 1: 1–863. 
  6. ^ Nesis, K. N. (1977). "The biology of paper nautiluses, Argonauta boettgeri and A. hians (Cephalopoda, Octopoda), in the western Pacific and the seas of the East Indian Archipelago". Zool. Zh. 56: 1004–1014. 
  7. ^ Okutani, T. & T. Kawaguchi (1983). "A mass occurrence of Argonauta argo (Cephalopoda: Octopoda) along the coast of Shimane Prefecture, Western Japan Sea". Venus 41: 281–290. 
  8. ^ a b David, P. M. (1965). "The surface fauna of the ocean". Endeavour (Oxford) 24: 95–100. doi:10.1016/0160-9327(65)90007-4. 
  9. ^ Kramp, P. L. (1956). "Pelagic Fauna". In A. Bruun, SV. Greve, H. Mielche and R. Spärck, editors. The Galathea Deep Sea Expedition 1950-1952. pp. 65–86. 
  10. ^ a b Heeger, T., U. Piatkowski & H. Möller (1992). "Predation on jellyfish by the cephalopod Argonauta argo". Marine Ecology Progress Series 88: 293–296. doi:10.3354/meps088293. 
  11. ^ a b Mangold, K. M., M. Vecchione & R. E. Young 1996. "Argonauta". Tree of Life web project. Retrieved 2006-09-13. 
  12. ^ Clarke, M. R. (1986). A Handbook for the Identification of Cephalopod Beaks. Oxford University Press. p. 244. 
  13. ^ Current Classification of Recent Cephalopoda[dead link]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!