Overview

Comprehensive Description

Description

 A small (up to 9 mm x 5 mm), conical or turban-shaped glossy shell of 5-6 whorls. Yellowish or white in colour with reddish-brown or purple streaks that often produce a zigzag pattern. Conspicuous white, calcareous operculum. Lateral lobes of the foot have 3 pairs of tentacles. Neck lobes both fringed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Banc d'Arguin, Belgian Exclusive Economic Zone, European waters (ERMS scope), Goote Bank, Irish Exclusive economic Zone, Kerkennah Islands, Koksijde, Mediterranean Sea, Portuguese Exclusive Economic Zone, South Coast of England, South Coast of Ireland, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Coast of England, West Coast of Ireland, Zembra
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rare in the north
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Unconfirmed type for Phasianella pullus Linnaeus, 1758
Catalog Number: USNM 178992
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
  • Unconfirmed type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 43 specimens in 3 taxa.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0 - 51
  Temperature range (°C): 11.845 - 17.140
  Nitrate (umol/L): 0.211 - 5.063
  Salinity (PPS): 35.203 - 38.444
  Oxygen (ml/l): 5.513 - 6.138
  Phosphate (umol/l): 0.095 - 0.336
  Silicate (umol/l): 1.247 - 2.448

Graphical representation

Depth range (m): 0 - 51

Temperature range (°C): 11.845 - 17.140

Nitrate (umol/L): 0.211 - 5.063

Salinity (PPS): 35.203 - 38.444

Oxygen (ml/l): 5.513 - 6.138

Phosphate (umol/l): 0.095 - 0.336

Silicate (umol/l): 1.247 - 2.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on rocky coasts from the lower shore to about 35 m, usually amongst red algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tricolia pullus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTGATTTTTGGTATTTGATCAGGGCTTGTGGGTACTGCTTTAAGTTTACTTATTCGAGCTGAATTAGGCCAGCCGGGGTCTTTGATTGGAAGT---GATCAGATCTATAATACTATTGTAACTGCTCACGCTTTTGTTATAATTTTTTTCTTAGTAATGCCTTTGATGATTGGGGGTTTTGGTAACTGAATAGTGCCGTTGATGTTGGGGGCTCCGGACATGGCATTCCCTCGTTTAAATAATATGAGTTTTTGGTTATTACCTCCCTCATTATTGTTATTGTTGGCTTCTGCGGGCGCAGGGGAAGGAGTGGGTACTGGCTGAACAGTCTACCCTCCACTTTCAACTAATGTGTTTCATTCAACTATATCGGTTGATTTGGCTATTTTTTCTCTTCACTTGGCAGGGATTTCGTCTATTTTGGGGGCGGTAAACTTCTTGTGTACTTGTTTTAACATGCGGCATAAGGGGCTTGTCTGATACCGTGTGCCACTATTTGTTTGGTCTGTAGCGGTTACCGCTTTTCTACTGTTGCTTTCTTTGCCGGTGTTGGCTGCGGTAATTACCATACTGTTGACAGATCGAAATTTTAATACTAGGTTTTTTGACCCGGCAGGAGGGGGAGATCCCATTCTGTATCAGCATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tricolia pullus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tricolia pullus

Tricolia pullus is a species of small sea snail, a marine gastropod mollusk in the family Phasianellidae.[1]

Contents

Subspecies

Subspecies within this species are not clearly distinguishable and are described on a geographical base. They include:

Description

The size of the plump, oval shell varies between 3 mm and 11 mm. The shell has five or six rounded, gently convex whorls with a smooth structure, the body whorl being the largest. The shell has a short, abrupt spire.There is no distinct umbilicus. The aperture is roundish oval with a conspicuous operculum is thick and has a white calcareous surface. The colour pattern of the shiny shell is very variable and goes from cream to white with pink or purple-brown spots spirally distributed in zigzag or flamed patterns. [2] [3]

The adults are gonochoristic, i.e. consisting of distinct males and females. The ova are released in the sea and fertilized externally. [4]

Distribution

This species is distributed in European waters, the Mediterranean Sea, the Sea of Azov, in the Atlantic Ocean along the Canaries and in the Indian Ocean along Madagascar. It is found in the sublittoral zone and deeper waters (up to 35 m) in often abundant numbers on red seaweeds (Laurencia, Lomentaria, Mastocarpus), collecting diatoms and detritus.

References

  1. ^ a b Tricolia pullus (Linnaeus, 1758).  Retrieved through: World Register of Marine Species on 2 October 2012.
  2. ^ Peter Hayward et al., The Sea Shore of Britain & Europe, Collins Pocket Guides, HarperCollins Publishers, 1996, ISBN 0-00-219955-6
  3. ^ (in Dutch) R.H. De Bruyne, Geïllustreerde Schelpenencyclopedie, Rebo Productions, 2003 ISBN 90-366-1361-2
  4. ^ Marie Lebour (1937), The Eggs and Larvae of the British Prosobranchs with Special Reference to those Living in the Plankton, Journal of the Marine Biological Association of the United Kingdom (1937), 22: 105-166, doi:10.1017/S0025315400011917
  • Dautzenberg, P. (1923). Liste préliminaire des mollusques marins de Madagascar et description de deux especes nouvelles. Journal de Conchyliologie 68: 21-74
  • Vera Fretter, Some observations on Tricolia pullus (L.) and Margarites helicinus (Fabricius), J. Mollus. Stud. (1955) 31 (3-4): 159-162.
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
  • Kantor Yu.I. & Sysoev A.V. (2006) Marine and brackish water Gastropoda of Russia and adjacent countries: an illustrated catalogue. Moscow: KMK Scientific Press. 372 pp. + 140 pls
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!