Overview

Comprehensive Description

The blanket octopus (Tremoctopus violaceus) is a rarely encountered pelagic species that spends its entire life cycle in the open ocean (Norman et al. 2002). Until the first observation of a living male off the northern Great Barrier Reef, Australia (Norman et al. 2002), males were known only from dead individuals picked up in trawls and plankton nets. Like other pelagic octopus species, T. violaceus exhibits sexual size dimorphism. The degree of sexual size dimorphism in this species, however, is extraordinary: Females may reach 2 m in length whereas the reproductively mature male collected by Norman et al. was just 2.4 cm long. Individual weights of males and females differ by a factor of at least 10,000 (Norman et al. 2002).

Additional information and images are available on the Tremoctopus genus page.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

semi-cosmopolitan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widely distributed in tropical and subtropical waters of all oceans.

Tremoctopus violaceus violaceus is found in the Atlantic and T. v. gracilis in the Indo-Pacific. Some authorities treat these two forms as distinct species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

epi-mesopelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 3 taxa.
Water temperature and chemistry ranges based on 37 samples.

Environmental ranges
  Depth range (m): 7 - 4572
  Temperature range (°C): 2.258 - 23.791
  Nitrate (umol/L): 0.122 - 32.228
  Salinity (PPS): 34.466 - 38.973
  Oxygen (ml/l): 3.594 - 6.184
  Phosphate (umol/l): 0.028 - 2.216
  Silicate (umol/l): 0.774 - 45.828

Graphical representation

Depth range (m): 7 - 4572

Temperature range (°C): 2.258 - 23.791

Nitrate (umol/L): 0.122 - 32.228

Salinity (PPS): 34.466 - 38.973

Oxygen (ml/l): 3.594 - 6.184

Phosphate (umol/l): 0.028 - 2.216

Silicate (umol/l): 0.774 - 45.828
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic (i.e., occurs in the surface zone, where sufficient light penetrates to support photosynthesis).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Male and small female Tremoctopus violaceus use Portugese Man-of-War (Physalia) tentacles for defense and possibly to help capture prey (see Behaviour section).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Predators

In a study of the diets of two billfish, the Mediterranean spearfish (Tetrapturus belone) and the swordfish (Xiphias gladius), in the central Mediterranean Sea, Romeo et al. (2009) reported that Tremoctopus violaceus was present in the diets of both fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

A remarkable method of defense has been documented for Tremoctopus violaceus. Jones (1963) noted that earlier reports had documented the occurrence of unidentified cnidarian tentacles on the arms of immature T. violaceus, and the suggestion had been made that this might be a defensive strategy, with the octopus actively acquiring these tentacles as weapons rather than just the result of a chance encounter. Subsequent observations by Jones revealed that these tentacles were from the Portugese Man-of-War (Physalia) and were attached in an orderly fashion to each row of suckers on each of its four dorsal arms, with none found on the four ventral arms. Jones noted anatomical features of the suckers that he proposed are adaptaions for holding cnidarian tentacles (see Jones 1963). Jones speculated that these weapons might also be used to aid in capturing prey.

Only the tiny males and females 7 cm or less in length have been observed carrying tentacles. Norman et al. (2002) speculate that males of this species may be so small in part because the evolutionary benefits of larger size cannot compensate for the loss of this effective weapon system. The fecundity benefit for females that comes with larger size, in contrast, might be sufficient to compensate for outgrowing the "tentacle weapon system". Reproductive competition among males may also drive the reduced size of males. Females have been found with multiple male arms in their mantle cavities (Thomas 1977), suggesting the possible importance of competition among males for fertilization opportunities. Maturing at a small size might allow earlier and greater investment in sperm than would otherwise be possible.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Norman et al. (2002) provide a description of reproductive behavior in this species: Mature male T. violaceus develop a large modified reproductive arm (hectocotylus) within a spherical pouch. When males mate, this pouch ruptures, sperm is injected into the tip of the modified arm, and the arm is severed and transferred to the female. The male presumably dies. Regenerating hectocotylised arms have never been found among the many dead males that have been captured in trawls. In benthic arm-dropping octopuses, arm regeneration takes about 6-8 weeks (Ward pers. comm. cited in Norman et al. 2002). If male T. violaceus mated more than once, regenerating males would likely have been encountered. The detached arm remains in the female's mantle cavity until it is used to fertilize her eggs (Thomas 1977).

Potential fecundity of T. violaceus violaceus (the Atlantic subspecies) was estimated by Laptikhovsky and Salman (2003) to be about 100,000-300,000, depending on female size, with eggs released in batches of 10,000-30,000 (first and last batches smaller). Laptikhovsky and Salman report that the spawning period lasts 0.5-1 month, with most eggs produced during the first one to two weeks. They also note that in both mature female T. violaceus they examined, only the left oviduct was found to be functional and to contain ripe eggs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Tremoctopus violaceus violaceus is found in the Atlantic and T. v. gracilis in the Indo-Pacific. Based on differences in the structure of the modified male reproductive arm, it is likely that these two forms are actually distinct species (Michael Vecchione, pers. comm., Dec. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional Adaptations

Functional adaptation

Deployable web distracts predators: blanket octopus
 

The membrane attached to some arms of the blanket octopus serves as a defense mechanism because it expands to distract predators and can be shed if necessary.

     
  "The appearance of the female is striking due to the wide, deep web attached to arms I and II (Portmann 1952), for which the name 'blanket' or 'handkerchief' octopus has been given (Voss and Williamson 1971). The web is most extensive between arms I and II and it can be expanded or contracted to a remarkable degree. Contractions of the web are due to transverse bands of muscle, each surrounded by elastic fibres which probably allow the web to expand after autotomy. Besides this the edge of the web, parallel with the arm, has a row of 'pouches' lined by glands; these may have a role in the attachment of the clusters of stalked eggs (Portmann 1952). Autotomy of the web occurs along visible fracture lines when the animal is distressed. The dorsal arms and web are held rolled back when the animal swims, but spread out if disturbed. The web undoubtedly has several functions, as it does in Argonauta…The web when fully extended was 600mm long and 300mm wide, and the animal had a mantle length of 180 mm." (Nixon and Young 2003:324)
  Learn more about this functional adaptation.
  • Nixon, Marian; Young, John Zachary. 2003. The Brains and Lives of Cephalopods. USA: Oxford University Press.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tremoctopus violaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTATATTTCATCTTTGGAATTTGATCAGGACTACTAGGAACTTCCCTAAGATTAATAATCCGAACAGAATTAGGACAACCAGGATCACTATTAAATGAC---GATCAACTGTACAATGTCATTGTAACAGCTCATGCATTTGTCATAATTTTTTTTTTAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATACTAGGAGCCCCAGACATAGCCTTCCCACGAATAAATAACATAAGATTTTGATTACTCCCTCCATCCCTAACACTCCTCTTAACCTCAGCAGCAGTAGAAAGAGGAGTAGGAACAGGATGAACTGTATACCCCCCCTTATCTAGCAATTTAGCTCATATAGGACCTTCCGTAGACTTAGCTATTTTCTCTCTTCACTTAGCAGGTATTTCCTCAATCCTAGGAGCAATCAATTTTATCACTACAATCATCAGCATACGATGAGAAGGAATACAAATAGAACGACTCCCCCTATTTGTATGATCTGTGTTAATTACAGCTGTCTTATTACTTCTCTCCCTTCCAGTTTTAGCTGGAGCAATTACTATACTTCTAACTGATCGAAATTTTAATACAACTTTTTTTGACCCTAGGGGAGGTGGGGACCCAATCCTTTACCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tremoctopus violaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common blanket octopus

The common blanket octopus or violet blanket octopus, Tremoctopus violaceus, is a large octopus of the family Tremoctopodidae found worldwide in the epipelagic zone of warm seas. The degree of sexual dimorphism in this species is very high, with females growing to two meters in length, whereas males, the first live specimen of which was seen off the Great Barrier Reef in 2002, grow to about 2.4 cm. Individual weights of males and females differ by a factor of about 10,000.[2]

Males and small females of less than 7 cm have been reported to carry with them the tentacles of the Portuguese man o' war, to whose poison they are immune. It is speculated that these tentacles serve both as a defensive mechanism and possibly as a method of capturing prey. This mechanism is no longer useful at larger sizes, which may be why males of this species are so small. The web between the arms of the mature female octopus serves as a defensive measure as well, making the animal appear larger, and being easily detached if bitten into by a predator.[2]

References[edit]

  1. ^ Sweeney, M.J. & R.E. Young (2004). Taxa Associated with the Family Tremoctopodidae Tryon, 1879. Tree of Life Web Project.
  2. ^ a b Shapiro, Leo. "Facts about Common Blanket Octopus". Encyclopedia of Life. Retrieved 21 March 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!