Overview

Brief Summary

Introduction

Bolitaena pygmaea is a small, lower mesopelagic to bathypelagic octopus. It is very similar in appearance to Japetella as small subadults but is distinguished primarily by the smaller eyes that are set on longer optic stalks.

Brief diagnosis:

A bolitaenid ...

  • with a ligula on the hectocotylus.
  • with small eyes on long optic stalks.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Left arm III hectocotylized in males with an elongate ligula. Third right arm sexually dimorphic with 1-3 greatly enlarged suckers in males.

      Figure. Male B. pygmaea. Left - View of right side showing enlarged sucker. Drawing from Chun, 1910. Right - Side view of the right arm and oral view of the left arm tip showing ligula. Drawings from Thore (1949).

  2. Eyes
    1. Eyes well removed from brain on long optic stalks but within head.
    2. Eyes small compared to Japetella of comprable size.

Comments

The distinctive hectocotylus makes identification of nearly mature males easy. Unfortunately these males are rarely seen. As a result, separation of this species from Japetella diaphana depends largely on the differences in eye size and length of the optic stalks.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Vertical distribution

In waters off Hawaii, Young (1978) found the distribution pattern shown on the right. Small octopods (ca. 5-15 mm ML) were found near 150-200 m depth or mostly below 600 m. One gravid female was captured at 1400 m. Two nearly mature males were taken at 1200 and 1425 m. Four brooding females were taken between 800 and 900 m.


Figure. Vertical distribution of B. pygmaea off Hawaii. Bars - Fishing range of opening/closing trawl; absence of bar indicates capture is from an open trawl. Circles- Modal depth of the trawl. Open yellow circles- Day captures. Filled blue circles- Night captures. Red dots with yellow cross-bars- Brooding females, day captures. Red dots with blue cross-bars- Brooding females, night capture. Red dot with green ring- Gravid female. Chart redrawn from Young, 1978.

Geographical distribution

This is a tropical-subtropical species found worldwide (Thore, 1949; Nesis, 1982).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Eledonella pygmaea Verrill, 1884
Catalog Number: USNM 35268
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Isopropyl Alcohol
Collector(s): United States Fish Commission
Year Collected: 1883
Locality: Approx. 640 km off of, Virginia, United States, North Atlantic Ocean
Depth (m): 5393 to 5393
Vessel: Albatross R/V
  • Holotype: Verrill, A. 1884. Trans. Conn. Acad. Arts Sci. 6: 145-6, pl. 32, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Abyssopelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bathypelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1901 - 2976
  Temperature range (°C): 3.364 - 3.468
  Nitrate (umol/L): 18.136 - 18.359
  Salinity (PPS): 34.965 - 34.966
  Oxygen (ml/l): 6.133 - 6.187
  Phosphate (umol/l): 1.159 - 1.175
  Silicate (umol/l): 15.017 - 15.679

Graphical representation

Depth range (m): 1901 - 2976

Temperature range (°C): 3.364 - 3.468

Nitrate (umol/L): 18.136 - 18.359

Salinity (PPS): 34.965 - 34.966

Oxygen (ml/l): 6.133 - 6.187

Phosphate (umol/l): 1.159 - 1.175

Silicate (umol/l): 15.017 - 15.679
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 77 samples.

Environmental ranges
  Depth range (m): 55 - 5393
  Temperature range (°C): 2.459 - 21.427
  Nitrate (umol/L): 0.217 - 25.818
  Salinity (PPS): 34.919 - 36.588
  Oxygen (ml/l): 3.584 - 6.141
  Phosphate (umol/l): 0.038 - 1.565
  Silicate (umol/l): 0.885 - 26.357

Graphical representation

Depth range (m): 55 - 5393

Temperature range (°C): 2.459 - 21.427

Nitrate (umol/L): 0.217 - 25.818

Salinity (PPS): 34.919 - 36.588

Oxygen (ml/l): 3.584 - 6.141

Phosphate (umol/l): 0.038 - 1.565

Silicate (umol/l): 0.885 - 26.357
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life history

Near sexual maturity, iridescence of the digestive gland and eyes is lost; pigmentation greatly increases in females, and arms become relatively longer. In addition, the posterior salivary glands of males become greatly enlarged (Voight, 1995). Females develop a yellow ring-shaped light organ around the mouth. Gravid females and nearly mature males (mature males are unknown) are found at the lower end of the vertical distribution range near 1200-1400 m. Brooding females, however, are found near 800 m off Hawaii.

Figure. Oral view of the brachial crown of B. pygmaea showing photophore, mature female, Northwest Atlantic. Photograph by M. Vecchione.

Hatchlings have a ML of about 2 mm and eggs are about the same length (Young, 1972). The early paralarvae of Bolitaena pygmaea have an abundance of chromatophores that easily separates them from Japetella diaphana if specimens are intact which they usually are not. The optic lobe of the brain is distinctly separated from the brain by a short optic stalk even in the paralarva. In Japetella diaphana paralarvae no such separation is apparent.

Figure. Dorsal and ventral views of a paralarva of B. pygmaea, 3.9 mm ML. Drawing modified from Hochberg, et al. (1992).

The life history appears to be very similar to that of Japetella diaphana. Present data suggest the following scenario:

Females, brooding clusters of interconnected eggs, float at a depth of around 800 m where downwelling sunlight is too low to reveal their presence. This is about as close as they can get to the surface in Hawaiian waters under this visibility constraint. Females do not feed while brooding and apparently die after the young hatch (Young, 1972). At a temperature of 4-5°C, brooding is expected to take at least several months. Hatchlings either swim upward to about 200 m depth where food presumably is more plentiful or are carried there by the female at the time of hatching. Young Bolitaena descend into mesopelagic depths as they grow, but the size at which they descend is variable (ca. 5-15 mm ML). At maturity the octopus descends to depths of about 1400 m where males probably first attract females then females attract males. Secretions from the enlarged posterior salivary glands of males could secrete pheromones to attract females (for an alternate view of the function of the enlarged salivary glands, see Voight, 1995). Presumably, as the female draws close and considers conditions safe, she will signal the male with the oral light organ and mating will occur.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bolitaena pygmaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCTTATATTTTATTTTCGGAATTTGATCAGGATTACTAGGTACATCTCTTAGATTAATAATCCGAACTGAATTAAGACAACCAGGATCTTTACTCAATGAT---GACCAATTATATAATGTAATTGTTACTGCCCATGCATTCGTAATAATCTTCTTTTTAGTTATACCTGTAATAATTGGAGGTTTTGGAAACTGATTAGTTCCCTTAATATTAGGAGCTCCTGACATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCATCTCTTACTCTACTTCTTATTCTGCTAGCAGTAGAAAGAGGAGCAGGAACAGGATGAACAGTATACCCCCCTCTATCTAGAAATGTCTCACATATAGGTCCATCTGTAGATCTTGCTATTTTTTCTCTTCACCTAGCTGGAGTATCCTCTATCTTAGGAGCAATTAACTTTATTACAACTATTATAAACATACGATGAGAAAGAATACAAATAGAACGACTTCCTCTATTTGTTTGATCTGTACTTATCACCGCAATTCTTTTATTACTTTCTCTTCCAGTACTAGCTGGAGCTATCACAATACTTCTTACAGATCGTAATTTCAATACAACATTTTTTGACCCAAGTGGTGGGGGTGATCCTATTCTTTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bolitaena pygmaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!