Physical Description

Type Information

Holotype for Eledonella pygmaea Verrill, 1884
Catalog Number: USNM 35268
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Isopropyl Alcohol
Collector(s): United States Fish Commission
Year Collected: 1883
Locality: Approx. 640 km off of, Virginia, United States, North Atlantic Ocean
Depth (m): 5393 to 5393
Vessel: Albatross R/V
  • Holotype: Verrill, A. 1884. Trans. Conn. Acad. Arts Sci. 6: 145-6, pl. 32, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Abyssopelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bathypelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 77 samples.

Environmental ranges
  Depth range (m): 55 - 5393
  Temperature range (°C): 2.459 - 21.427
  Nitrate (umol/L): 0.217 - 25.818
  Salinity (PPS): 34.919 - 36.588
  Oxygen (ml/l): 3.584 - 6.141
  Phosphate (umol/l): 0.038 - 1.565
  Silicate (umol/l): 0.885 - 26.357

Graphical representation

Depth range (m): 55 - 5393

Temperature range (°C): 2.459 - 21.427

Nitrate (umol/L): 0.217 - 25.818

Salinity (PPS): 34.919 - 36.588

Oxygen (ml/l): 3.584 - 6.141

Phosphate (umol/l): 0.038 - 1.565

Silicate (umol/l): 0.885 - 26.357
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bolitaena pygmaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCTTATATTTTATTTTCGGAATTTGATCAGGATTACTAGGTACATCTCTTAGATTAATAATCCGAACTGAATTAAGACAACCAGGATCTTTACTCAATGAT---GACCAATTATATAATGTAATTGTTACTGCCCATGCATTCGTAATAATCTTCTTTTTAGTTATACCTGTAATAATTGGAGGTTTTGGAAACTGATTAGTTCCCTTAATATTAGGAGCTCCTGACATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCATCTCTTACTCTACTTCTTATTCTGCTAGCAGTAGAAAGAGGAGCAGGAACAGGATGAACAGTATACCCCCCTCTATCTAGAAATGTCTCACATATAGGTCCATCTGTAGATCTTGCTATTTTTTCTCTTCACCTAGCTGGAGTATCCTCTATCTTAGGAGCAATTAACTTTATTACAACTATTATAAACATACGATGAGAAAGAATACAAATAGAACGACTTCCTCTATTTGTTTGATCTGTACTTATCACCGCAATTCTTTTATTACTTTCTCTTCCAGTACTAGCTGGAGCTATCACAATACTTCTTACAGATCGTAATTTCAATACAACATTTTTTGACCCAAGTGGTGGGGGTGATCCTATTCTTTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bolitaena pygmaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!