Ecology

Habitat

Depth range based on 59 specimens in 7 taxa.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 98 - 3806
  Temperature range (°C): 1.458 - 8.336
  Nitrate (umol/L): 28.976 - 44.123
  Salinity (PPS): 34.560 - 34.984
  Oxygen (ml/l): 1.128 - 4.956
  Phosphate (umol/l): 1.891 - 3.142
  Silicate (umol/l): 16.797 - 176.733

Graphical representation

Depth range (m): 98 - 3806

Temperature range (°C): 1.458 - 8.336

Nitrate (umol/L): 28.976 - 44.123

Salinity (PPS): 34.560 - 34.984

Oxygen (ml/l): 1.128 - 4.956

Phosphate (umol/l): 1.891 - 3.142

Silicate (umol/l): 16.797 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lamellibrachia cf. luymesi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAACAGGTTTAGTAGCCACTAGAATAAGACTATTAATTCGAGCTGAACTTGGTCAGCCCGGAACACTCTTAGGAGAT---GACCAAATTTACAATTGCCTTATTACAGCTCATGGGCTTCTAATAATATTTTTTGTGGTCCTCCCTATTTTAATAGGAGGGTTTGGAAATTGACTAGTTCCTTTAATACTTGGAGCCCCCGACATAGCTTTCCCACGAATCAACAATCTAGGATTTTGACTAATTCCCCCCGCAGTAATCTTACTAGTAATATCCGCTTTTATTGAAAAAGGTGCCGGAACAGGATGAACTGTTTACCCTCCCTTAGCATCCAATATTGCTCATGCAGGACCATGCATTGACCTAGCCATTTTTGCTCTACACCTCTCAGGTGTATCCTCAATTCTAGCCTCAATTAACTTCATTACTACTGTAATAAACATACGATATAAAGGATTACGTCTAGAACGGGTTCCTTTATTTGTATGAAGAGTTAAACTAACCGCAGTTCTTCTTCTCCTTTCAATTCCAGTTCTTGCAGGAGGACTTACCATATTACTTACAGACCGAAACTTAAATACATCCTTCTTTGACCCAGCAGGAGGAGGAGATCCAGTTCTATATCAACATTTATTCTGATTCTTCGGCCACCCAGAAGTATACATTTTAGTACTTCCAGGCTTTGGTCTAATTTCTCACTTAGTAGCTCACCATTCTGCCAAACTCGAACCATTCGGTTCACTAGGAATAATTTATGCCATAATAGGAATTGGGTTAATTGGGTTCCTAGTATGAGCCCACCATATATTTACCATTGGAATAGATGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lamellibrachia cf. luymesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:65Public Records:58
Specimens with Sequences:65Public Species:13
Specimens with Barcodes:65Public BINs:9
Species:15         
Species With Barcodes:15         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lamellibrachia

Lamellibrachia is a genus of tube worms related to the giant tube worm, Riftia pachyptila. It lives at deep-sea cold seeps where hydrocarbons (oil and methane) are leaking out of the seafloor. It is entirely reliant on internal, sulfide-oxidizing bacterial symbionts for its nutrition.

L. luymesi provides the bacteria with hydrogen sulfide and oxygen by taking them up from the environment and binding them to a specialized hemoglobin molecule. Unlike the tube worms that live at hydrothermal vents, Lamellibrachia uses a posterior extension of its body called the root to take up hydrogen sulfide from the seep sediments. Lamellibrachia may also help fuel the generation of sulfide by excreting sulfate through their roots into the sediments below the aggregations.[1]

The most well-known seeps where L. luymesi lives are in the northern Gulf of Mexico from 500 to 800 m depth. This tube worm can reach lengths of over 3 m (10 ft), and grows very slowly, with individuals living to be over 250 years old.[2] It forms biogenic habitat by creating large aggregations of hundreds to thousands of individuals. Living in these aggregations are over a hundred different species of animals, many of which are found only at these depths.

While most species of vestimentiferan tubeworms live in deep waters below the photic zone, Lamellibrachia satsuma was discovered in Kagoshima Bay, Kagoshima at a depth of only 82 m, the shallowest depth record for a vestimentiferan.

Species

References

  1. ^ Cordes, E. E.; Arthur, M. A.; Shea, K.; Arvidson, R. S.; Fisher, C. R. (2005). "Modeling the Mutualistic Interactions between Tubeworms and Microbial Consortia". PLoS Biology 3 (3): e77. doi:10.1371/journal.pbio.0030077. PMC 1044833. PMID 15736979.  edit
  2. ^ MacDonald, Ian R. (2002). "Stability and Change in Gulf of Mexico Chemosynthetic Communities" (PDF). MMS. Retrieved 2011-09-06. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!