Ecology

Habitat

Depth range based on 1 specimen in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3850 - 3850
  Temperature range (°C): 2.248 - 2.248
  Nitrate (umol/L): 17.834 - 17.834
  Salinity (PPS): 34.902 - 34.902
  Oxygen (ml/l): 6.322 - 6.322
  Phosphate (umol/l): 1.255 - 1.255
  Silicate (umol/l): 26.760 - 26.760
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

Formerly in family Spirobrachiidae
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spirobrachia cf. grandis SJ-2009

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTACTCCCCTTAATA---TTAGGAGCACCTGATATAGCTTTTCCTCGAGTAAATAATTTAGGATTTTGACTTCTTCCTCCTGCAGTAATCCTTTTAGTAATATCAGCTTTTATTGAAAAAGGAGCCGGAACCGGGTGAACAGTCTACCCTCCTTTAGCTTCTAATTTAGCTCATGCAGGCCCTTCAATTGATTTA---GCAATTTTTTCTATCCATTTATCCGGACTTTCTTCTATCCTCGGATCAATTAATTTTATTACGACAGTCATAAATATACGCTATAAAGGACTACGTCTAGAACGAGTTCCTCTTTATGTCTGAAGAGTCAAACTTACAGCTATTCTTCTTCTTTTATCAGTTCCTATTTTAGCTGGA---GGTCTTACTATGCTTCTAACAGACCGAAACTTAAACACATCTTTTTTTGACCCTAGAGGAGGGGGGGACCCAGTTCTATTTCAACATTTGTTTTGATTTTTTGGTCACCCAGAAGTATACATCTTAATTCTCCCAGGTTTTGGTTTAATTTCTCATTTAGTAACTCATTATACATCTAAATTA---GAACCTTTTGGATCTCTAGGAATAATTTATGCAATAATAGGAATTGGTTTAATCGGATTTTTAGTATGAGCTCATCATATATTTACTATTGGAATAGATGTAGACACTCGTGCTTATTTTACTGCCGCAACAATAATTATTGCTGTCCCTACAGGAATTAAAATTTTTAGGTGACTG---GCAACTATTCATGGCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spirobrachia cf. grandis SJ-2009

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 13
Specimens with Sequences: 7
Specimens with Barcodes: 7
Species: 2
Species With Barcodes: 2
Public Records: 7
Public Species: 2
Public BINs: 2
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!