Overview

Brief Summary

Biology

Like all cephalopods, the common octopus is an intelligent active predator (4). They have modified salivary glands that produce venom used to incapacitate prey. It is often easy to identify what a common octopus has been feeding on, as they leave piles of debris known as 'middens' around the entrance of the protective lair in which they live. These middens consist of debris from a range of species and often include mollusc shells and the carapaces of crabs and other crustaceans (5). All cephalopods are good swimmers, and are able to move rapidly by jet propulsion when threatened; water is rapidly expelled through a funnel which causes the octopus to be propelled away rapidly (3). Cephalopods are also able to mask themselves as they escape with a cloud of ink released into the water (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The cephalopods (meaning 'head-footed) are a group of molluscs that contain the octopuses, squid and cuttlefish, and are probably the most intelligent of all invertebrates. They have well-developed heads, with large complex eyes and mouths that feature beak-like jaws. All octopuses have eight tentacle-like arms; indeed 'octopus' derives from the Greek for 'eight-footed' (3). The common octopus usually measures around 60 centimetres in length, but it can grow up to 1 metre (2). It is able to change its colour depending on its mood and situation, but individuals are usually greyish-yellow or brownish-green with extensive mottling. They are often very well camouflaged (2). The body is warty, and the thick arms bear two rows of suckers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A medium to large sized octopus reaching up to 1.3 meters in length, with a distinctly warty body.
The arms are thick and stout bearing two rows of longitudinal suckers.
The colour varies from grey-yellow-brown-green and can change according to the situation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This species has a world-wide distribution. It is abundant in the Mediterranean Sea, the Eastern Atlantic Ocean, and in Japanese waters.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Occurs primarily south of Cape Hatteras, but it is distributed as far north as Connecticut.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-global
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This octopus is found from the southern North Sea down to South Africa. It also occurs in the Mediterranean (2). It reaches the north-eastern extreme of its range in Britain where it is found only around the coasts of the south and south west (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Reach 1-3 feet in length including arms. The skin is smooth. Like other octopuses, members of this species have 8 arms that are lined with suckers, and they lack any internal shell.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Octopus vulgaris is found in tropical, subtropical, and temperate waters between the surface and a depth of 100 to 150 meters. . It is not found in polar or subpolar regions. It lives in costal waters and the upper part of the continental shelf.

Habitat Regions: temperate ; tropical

Aquatic Biomes: benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal to shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 549 specimens in 1 taxon.
Water temperature and chemistry ranges based on 370 samples.

Environmental ranges
  Depth range (m): 0.5 - 1864
  Temperature range (°C): 3.818 - 27.681
  Nitrate (umol/L): 0.115 - 26.999
  Salinity (PPS): 32.547 - 38.698
  Oxygen (ml/l): 3.323 - 6.460
  Phosphate (umol/l): 0.091 - 2.101
  Silicate (umol/l): 0.756 - 22.185

Graphical representation

Depth range (m): 0.5 - 1864

Temperature range (°C): 3.818 - 27.681

Nitrate (umol/L): 0.115 - 26.999

Salinity (PPS): 32.547 - 38.698

Oxygen (ml/l): 3.323 - 6.460

Phosphate (umol/l): 0.091 - 2.101

Silicate (umol/l): 0.756 - 22.185
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 4 - 4
  Temperature range (°C): 27.537 - 27.537
  Nitrate (umol/L): 0.447 - 0.447
  Salinity (PPS): 34.880 - 34.880
  Oxygen (ml/l): 4.613 - 4.613
  Phosphate (umol/l): 0.121 - 0.121
  Silicate (umol/l): 2.033 - 2.033
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found on rocky coasts, shallow sublittoral. Has adapted to live in very different habitats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs along rocky coasts in the shallow sublittoral zone (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Octopus vulgaris are active predators that feed primarily on gastropods and bivalves. Small hatchlings typically spend several weeks as active predators in the plankton before they settle down to the benthic mode of life at a size of about 0.2 grams.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The duration of embryonic development is related to temperature, as it is in all cephalopods, and it also depends on the size of the egg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Octopus vulgaris has individuals of both sexes. During mating, the male approaches the female, who fends him off for a while, but then accepts him. He sits next to her or mounts her, inserting the hectocotylus in her mantle cavity to pass the spermatophores. They may copulate for several hours. The same pair often repeat mating over a period of a week or so, but a male copulates with other females and a female accepts other males. Mating often occurs when the females are immature. Only females ready to lay eggs consistently fend off the males.

Mating System: polygynandrous (promiscuous)

Females become restless and search for a sheltered place where they can lay and brood the eggs without disturbance. The spermatophores are placed in the oviducts and empty cases are discarded. Fertilization takes place in the oviductal glands as the mature eggs pass through them on thir way out of the oviducts. Two secretions from the oviductal glands, together with the mucus, are used to stick the egg stalks together in strings and attach these to a substrate. Eggs are laid in shallow water. They are always attached to a substrate. On rocky shores, females find a hole, a crevice or sheltered place and they often protect their homes with shells, stones and other solid objects that they gather. Coral reefs provide suitable shelter. On sandy or muddy bottom, eggs are laid in empty mollusc shells or in man-made objects such as cans, tins, bottles, tires, boots, and amphorae . In tropical and subtropical waters, eggs are laid throughout the year. The total number of eggs laid by a female varies from 100,000 to 500,000. During egg laying and subsequent brooding, the female rarely leaves the egg mass. She usually does not feed during the entire period of spawning and brooding, which can be as long as 4-5 months at low temperatures. Egg care includes cleaning the eggs with the arm tips and directing jets of water from the funnel through the strings. Intruders, including potential prey, are pushed away, although crabs left overnight may occasionally be eaten. As a rule, females die shortly after the hatching of the last embryos after losing one-third of their pre-spawning weight.

Range number of offspring: 100000 to 500000.

Key Reproductive Features: semelparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Octopus vulgaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGAATATTCTCAACAAATCATAAAGATATTGGTACACTATACTTCATTTTTGGAATTTGATCAGGACTTTTAGGTACCTCCTTAAGTTTAATAATTCGAACAGAACTAGGACAACCAGGATCCCTCCTAAATGATGATCAATTATATAATGTAATTGTTACAGCTCACGCATTTGTTATAATTTTTTTCCTTGTTATACCAGTTATAATCGGAGGATTTGGAAACTGATTGGTTCCTTTAATACTAGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTCTTACCTCCTTCTCTTACTCTTCTCCTTTCATCTGCAGCAGTTGAAAGAGGCGCAGGTACCGGATGAACCGTTTACCCGCCTCTTTCAAGAAATTTAGCTCATATAGGACCTTCTGTTGATCTAGCCATTTTCTCACTTCACTTAGCAGGTATTTCATCAATCCTTGGAGCCATCAACTTTATTACAACTATTATTAATATACGATGAGAAGGTATATTAATAGAACGACTTCCACTATTTGTATGATCTGTATTTATTACCGCAATTTTACTATTACTATCATTACCAGTACTCGCTGGAGCAATTACTATACTTTTAACTGACCGAAATTTTAATACTACATTTTTTGATCCTAGTGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTCTTTGGTCACCCAGAAGTATATATTCTAATTTTACCAGGATTTGGTATAATTTCACATATTGTTTCCCATTATTCTTTAAAAAAAGAAACTTTCGGAAGACTCGGTATAATCTACGCAATATTATCAATTGGACTCTTAGGATTTATTGTTTGAGCACACCATATATTTACAGTTGGTATAGATGTAGACACACGAGCATATTTTACAGCCGCCACAATAATTATTGCAATTCCCACAGGAATTAAAGTATTTAGTTGATTAGCTACTATCTATGGTTCCCCTATCAAATACACTCCCCCCATGTTATGATCATTAGGATTTATTTTTCTATTTACTACTGGAGGACTAACTGGTATTGTTCTATCTAATTCATCACTAGATATTATACTCCATGATACATACTATGTAGTTGCACATTTCCATTATGTATTATCTATAGGAGCTGTTTTTGCCTTATTTGCAGGATTCACCCACTGATATCCTCTAATTACAGGCCTATCCTTAAATCAACAATATACCAAATCCCATTTCTACATAATATTCATTGGAGTAAATATTACTTTCTTTCCACAACACTTTTTAGGATTAGCAGGTATACCACGACGATATTCAGATTATCCTGACTCCTACACCAAATGAAATATAGTCTCATCTATAGGATCACTTTTATCACTAACTTCCATTATATTTTTCATATTTATTGTATGAGAAAGATTAATTTCCCAACGAACTATTATTTGATCAAACCACTTAAATACATCTTTAGAATGAGACAACCGTCTTCCAGTCGATTTTCATAATCAAATAGAAACTGGAGCCTTATTTATTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus vulgaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 67
Specimens with Barcodes: 193
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

There is the potential for the overfishing of these animals, which threatens their proliferation. However, at this time, they are not at any specific risk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In 1975, some 121,000 tons of O. vulgaris were caught by fisheries. In 1976, the number was 137,000 tons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!