Octopus vulgaris — Details

Common Octopus learn more about names for this taxon

EOL is scheduled for maintenance on Thursday, June 20 between 8:00 and 10:00 AM EDT.
During this time you may find changes in EOL's performance and availability.

Overview

Brief Summary

Biology

Like all cephalopods, the common octopus is an intelligent active predator (4). They have modified salivary glands that produce venom used to incapacitate prey. It is often easy to identify what a common octopus has been feeding on, as they leave piles of debris known as 'middens' around the entrance of the protective lair in which they live. These middens consist of debris from a range of species and often include mollusc shells and the carapaces of crabs and other crustaceans (5). All cephalopods are good swimmers, and are able to move rapidly by jet propulsion when threatened; water is rapidly expelled through a funnel which causes the octopus to be propelled away rapidly (3). Cephalopods are also able to mask themselves as they escape with a cloud of ink released into the water (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cephalopods (meaning 'head-footed) are a group of molluscs that contain the octopuses, squid and cuttlefish, and are probably the most intelligent of all invertebrates. They have well-developed heads, with large complex eyes and mouths that feature beak-like jaws. All octopuses have eight tentacle-like arms; indeed 'octopus' derives from the Greek for 'eight-footed' (3). The common octopus usually measures around 60 centimetres in length, but it can grow up to 1 metre (2). It is able to change its colour depending on its mood and situation, but individuals are usually greyish-yellow or brownish-green with extensive mottling. They are often very well camouflaged (2). The body is warty, and the thick arms bear two rows of suckers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A medium to large sized octopus reaching up to 1.3 meters in length, with a distinctly warty body.
The arms are thick and stout bearing two rows of longitudinal suckers.
The colour varies from grey-yellow-brown-green and can change according to the situation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Europe, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Isles, Comores, D. João de Castro Bank, Dutch Exclusive Economic Zone, East Atlantic, English Channel, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Kenya, Madagascar, Moroccan Exclusive Economic Zone, Mozambique, Mtwapa, Namibia, Nice, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Somalia, South Africa (country), Southern Bight, Spanish Exclusive Economic Zone, Stroombank, Tanzania, Ungama Bay, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

This species has a world-wide distribution. It is abundant in the Mediterranean Sea, the Eastern Atlantic Ocean, and in Japanese waters.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Occurs primarily south of Cape Hatteras, but it is distributed as far north as Connecticut.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-global
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This octopus is found from the southern North Sea down to South Africa. It also occurs in the Mediterranean (2). It reaches the north-eastern extreme of its range in Britain where it is found only around the coasts of the south and south west (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Reach 1-3 feet in length including arms. The skin is smooth. Like other octopuses, members of this species have 8 arms that are lined with suckers, and they lack any internal shell.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Octopus vulgaris is found in tropical, subtropical, and temperate waters between the surface and a depth of 100 to 150 meters. . It is not found in polar or subpolar regions. It lives in costal waters and the upper part of the continental shelf.

Habitat Regions: temperate ; tropical

Aquatic Biomes: benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

coastal to shelf
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 549 specimens in 1 taxon.
Water temperature and chemistry ranges based on 370 samples.

Environmental ranges
  Depth range (m): 0.5 - 1864
  Temperature range (°C): 3.818 - 27.681
  Nitrate (umol/L): 0.115 - 26.999
  Salinity (PPS): 32.547 - 38.698
  Oxygen (ml/l): 3.323 - 6.460
  Phosphate (umol/l): 0.091 - 2.101
  Silicate (umol/l): 0.756 - 22.185

Graphical representation

Depth range (m): 0.5 - 1864

Temperature range (°C): 3.818 - 27.681

Nitrate (umol/L): 0.115 - 26.999

Salinity (PPS): 32.547 - 38.698

Oxygen (ml/l): 3.323 - 6.460

Phosphate (umol/l): 0.091 - 2.101

Silicate (umol/l): 0.756 - 22.185
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 4 - 4
  Temperature range (°C): 27.537 - 27.537
  Nitrate (umol/L): 0.447 - 0.447
  Salinity (PPS): 34.880 - 34.880
  Oxygen (ml/l): 4.613 - 4.613
  Phosphate (umol/l): 0.121 - 0.121
  Silicate (umol/l): 2.033 - 2.033
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on rocky coasts, shallow sublittoral. Has adapted to live in very different habitats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs along rocky coasts in the shallow sublittoral zone (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Octopus vulgaris are active predators that feed primarily on gastropods and bivalves. Small hatchlings typically spend several weeks as active predators in the plankton before they settle down to the benthic mode of life at a size of about 0.2 grams.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

The duration of embryonic development is related to temperature, as it is in all cephalopods, and it also depends on the size of the egg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Octopus vulgaris has individuals of both sexes. During mating, the male approaches the female, who fends him off for a while, but then accepts him. He sits next to her or mounts her, inserting the hectocotylus in her mantle cavity to pass the spermatophores. They may copulate for several hours. The same pair often repeat mating over a period of a week or so, but a male copulates with other females and a female accepts other males. Mating often occurs when the females are immature. Only females ready to lay eggs consistently fend off the males.

Mating System: polygynandrous (promiscuous)

Females become restless and search for a sheltered place where they can lay and brood the eggs without disturbance. The spermatophores are placed in the oviducts and empty cases are discarded. Fertilization takes place in the oviductal glands as the mature eggs pass through them on thir way out of the oviducts. Two secretions from the oviductal glands, together with the mucus, are used to stick the egg stalks together in strings and attach these to a substrate. Eggs are laid in shallow water. They are always attached to a substrate. On rocky shores, females find a hole, a crevice or sheltered place and they often protect their homes with shells, stones and other solid objects that they gather. Coral reefs provide suitable shelter. On sandy or muddy bottom, eggs are laid in empty mollusc shells or in man-made objects such as cans, tins, bottles, tires, boots, and amphorae . In tropical and subtropical waters, eggs are laid throughout the year. The total number of eggs laid by a female varies from 100,000 to 500,000. During egg laying and subsequent brooding, the female rarely leaves the egg mass. She usually does not feed during the entire period of spawning and brooding, which can be as long as 4-5 months at low temperatures. Egg care includes cleaning the eggs with the arm tips and directing jets of water from the funnel through the strings. Intruders, including potential prey, are pushed away, although crabs left overnight may occasionally be eaten. As a rule, females die shortly after the hatching of the last embryos after losing one-third of their pre-spawning weight.

Range number of offspring: 100000 to 500000.

Key Reproductive Features: semelparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Octopus vulgaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGAATATTCTCAACAAATCATAAAGATATTGGTACACTATACTTCATTTTTGGAATTTGATCAGGACTTTTAGGTACCTCCTTAAGTTTAATAATTCGAACAGAACTAGGACAACCAGGATCCCTCCTAAATGATGATCAATTATATAATGTAATTGTTACAGCTCACGCATTTGTTATAATTTTTTTCCTTGTTATACCAGTTATAATCGGAGGATTTGGAAACTGATTGGTTCCTTTAATACTAGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTCTTACCTCCTTCTCTTACTCTTCTCCTTTCATCTGCAGCAGTTGAAAGAGGCGCAGGTACCGGATGAACCGTTTACCCGCCTCTTTCAAGAAATTTAGCTCATATAGGACCTTCTGTTGATCTAGCCATTTTCTCACTTCACTTAGCAGGTATTTCATCAATCCTTGGAGCCATCAACTTTATTACAACTATTATTAATATACGATGAGAAGGTATATTAATAGAACGACTTCCACTATTTGTATGATCTGTATTTATTACCGCAATTTTACTATTACTATCATTACCAGTACTCGCTGGAGCAATTACTATACTTTTAACTGACCGAAATTTTAATACTACATTTTTTGATCCTAGTGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTCTTTGGTCACCCAGAAGTATATATTCTAATTTTACCAGGATTTGGTATAATTTCACATATTGTTTCCCATTATTCTTTAAAAAAAGAAACTTTCGGAAGACTCGGTATAATCTACGCAATATTATCAATTGGACTCTTAGGATTTATTGTTTGAGCACACCATATATTTACAGTTGGTATAGATGTAGACACACGAGCATATTTTACAGCCGCCACAATAATTATTGCAATTCCCACAGGAATTAAAGTATTTAGTTGATTAGCTACTATCTATGGTTCCCCTATCAAATACACTCCCCCCATGTTATGATCATTAGGATTTATTTTTCTATTTACTACTGGAGGACTAACTGGTATTGTTCTATCTAATTCATCACTAGATATTATACTCCATGATACATACTATGTAGTTGCACATTTCCATTATGTATTATCTATAGGAGCTGTTTTTGCCTTATTTGCAGGATTCACCCACTGATATCCTCTAATTACAGGCCTATCCTTAAATCAACAATATACCAAATCCCATTTCTACATAATATTCATTGGAGTAAATATTACTTTCTTTCCACAACACTTTTTAGGATTAGCAGGTATACCACGACGATATTCAGATTATCCTGACTCCTACACCAAATGAAATATAGTCTCATCTATAGGATCACTTTTATCACTAACTTCCATTATATTTTTCATATTTATTGTATGAGAAAGATTAATTTCCCAACGAACTATTATTTGATCAAACCACTTAAATACATCTTTAGAATGAGACAACCGTCTTCCAGTCGATTTTCATAATCAAATAGAAACTGGAGCCTTATTTATTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Octopus vulgaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 171
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

There is the potential for the overfishing of these animals, which threatens their proliferation. However, at this time, they are not at any specific risk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

In 1975, some 121,000 tons of O. vulgaris were caught by fisheries. In 1976, the number was 137,000 tons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common octopus

The common octopus (Octopus vulgaris) is the most studied of all octopus species. Its range in the eastern Atlantic extends from the Mediterranean Sea and the southern coast of England to at least Senegal in Africa. It also occurs off the Azores, Canary Islands, and Cape Verde Islands.[1] The species is also common in the Western Atlantic.[2]

Contents

Characteristics [edit]

O. vulgaris from the Mediterranean Sea
Common octopus, Staatliches Museum für Naturkunde Karlsruhe, Germany

O. vulgaris grows to 25 cm in mantle length with arms up to 1 m long.[1] O. vulgaris is caught by bottom trawls on a huge scale off the northwestern coast of Africa. More than 20,000 tonnes are harvested annually.[1]

The common octopus hunts at dusk. Crabs, crayfish, and bivalve mollusks (two-shelled molluscs such as cockles) are preferred, although the octopus will eat almost anything it can catch. It is able to change colour to blend in with its surroundings, and is able to jump upon any unwary prey that strays across its path. The prey is paralyzed by a nerve poison, which the octopus secretes in its saliva, and the octopus is able to grasp its prey using its powerful arms with their two rows of suckers. If the victim is a shelled mollusc, the octopus uses its beak to punch a hole in the shell before sucking out the fleshy contents.[citation needed]

Training experiments have shown the common octopus can distinguish the brightness, size, shape, and horizontal or vertical orientation of objects. They are intelligent enough to learn how to unscrew a jar and are known to raid lobster traps.[3][4] O. vulgaris is the only invertebrate animal protected by the Animals (Scientific Procedures) Act 1986 in the UK;[5] it was included because of its high intelligence.[citation needed]

See also [edit]

References [edit]

  1. ^ a b c Norman, M.D. 2000. Cephalopods: A World Guide. ConchBooks.
  2. ^ Species Fact Sheets: Octopus vulgaris (Lamarck, 1798). FAO Fisheries & Aquaculture.
  3. ^ http://www.youtube.com/watch?v=BO1PnQ-1-pY
  4. ^ http://www.youtube.com/watch?v=LEvXcocqmYE
  5. ^ "The Animals (Scientific Procedures) Act(Amendment) Order 1993". August 23, 1993. Retrieved February 22, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!