Overview

Brief Summary

Introduction

The vampire squid is rather small, reaching a maximum of 13 cm ML (Nesis, 1982/7), and is very gelatinous; its consistency is that of a jellyfish. It occupies meso- to bathypelagic depths throughout the tropical and temperate regions of the world's oceans. The second pair of arms is modified into retractile filaments that can extend to lengths well in excess of the total length of the animal, and they can be retracted into pockets within the web. The filaments, presumably, have a sensory function. The vampire has black chromatophores with reddish-brown ones interspersed. These chromatophores, however, have lost the muscles that enable rapid color change in other coleoids and are probably incapable of changing shape. A few normal chromatophores associated with photophores are still present.

The vampire is a phylogenetic relict and possesses features of both octopods and decapods. In addition, it has many features that are probably adaptations to the deep-sea environment. Among these are the loss of the ink sac and most active chromatophores, development of photophores and the gelatinous consistency of the tissues.

Brief diagnosis:

An octopodiform ...

  • with arms II modified as slender filaments.
  • with cirri but without suckers on the proximal halves of arms.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Nomenclature

A list of all nominal genera and species in the Vampyroteuthidae can be found here. The list includes the current status and type species of all genera, and the current status, type repository and type locality of all species and all pertinent references.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Arms
    1. "Arms II" are retractile filaments.
    2. Lateral cirri present over arm length; suckers present only on distal half of arms where they alternate with cirri.
    3. Suckers without cuticular lining; sucker stalks constricted to narrow plate at base of sucker.

      Figure. Ventro-oral view of V. infernalis with arms folded aborally, showing cirri without associated suckers in proximal half of arms. Note the sparse red pigment and the colorless, oral tips of the arms. Photographed in a shipboard aquarium prior to fixation by David Shale

  2. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.
    2. Nuchal cartilage present.
    3. Central nervous system with incipient inferior frontal lobe system; superior buccal lobes adjacent (fused at edges) to posterior buccal lobes; suprabrachial commissure lies within brain.

  3. Funnel
    1. Funnel valve absent.

  4. Mantle
    1. Dorsal mantle cavity absent.

  5. Fins
    1. Two pairs of fins present during ontogeny.

  6. Spermatangia
    1. Receptacle (deep sac) for spermatangia located anterior to each eye in females.

  7. Shell
    1. Shell a gladius with broad median field and broad conus.

  8. Photophores
    1. Large circular, lidded organs present posterior to each adult fin ("fin-base" organs).
    2. Numerous small organs distributed over ventral surfaces of mantle, funnel, head and aboral surface of arms and web ("skin-nodule" organs). Two patches on dorsal surface of head look like aggregrated small photophores but are photoreceptors (Herring, et al., 1994).
    3. Arm-tip organ(s) produce luminescent clouds consisting of microscopic glowing particles (Robison, et al., 2003).
    4. Arm-tip organs that flash or glow (Hunt, 1996).
    5. Insitu photographs of the vampire squid showing the "skin-nodule" photophores can be seen here.

  9. Viscera
    1. Oviducal glands at terminal end of oviducts.
    2. Visceropericardial coelom extends posteriorly as a slender duct, possibly a remnant siphuncle.
    3. Photosensitive vesicles located immediately dorsal to funnel and, possibly, on dorsal integument in nuchal region.

Comments

A drawing and photographs of the mantle cavity can be seen here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The vampire squid occupies meso- to bathypelagic depths throughout the world's tropical and temperate oceans where little to no light penetrates. The vampire squid is vertically distributed between depths of 300-3000m with a majority of vampire squids occupying depths of 1,500-2,500m. Studies conducted at the Monterey Bay Aquarium Research Institute in California revealed that the Vampyroteuthis infernalis is confined to the oxygen minimum layer in this bay at an average depth of 690m and oxygen levels of 0.22 ml/l. The vampire squid's north-south distribution is localized between the fortieth degree north and south latitudes where the water is 2-6 degrees Celsius.

(Grzimek 1972)

(Wood and Ellis 1999)

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

semi-cosmopolitan
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Mexico, New Zealand Exclusive Economic Zone, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Vertical Distribution

Off California trawling data show most vampires between depths of 600-1100 m with peaks at 700-800 m and 900-1000 m, and with small individuals of less than 20 mm being most abundant at the deeper peak (Roper and Young, 1975). ROV observations in Monterey Bay, California suggest that the vampire is restricted to the oxygen minimum layer in this bay at an average depth of 690 m and oxygen levels of 0.22 ml/l Hunt, 1996.

Vertical distribution chart modified from Clarke and Lu, 1975.

Off Hawaii, 10 of 11 captures came from depths of 800-1200 m but little towing was done in deeper water. Two captures were from opening-closing nets at depths of about 800-950 m.

In the Atlantic at 18° N, 25° W, the vampire shows a peak distribution between 700 and 1200 m but without a clear size/depth pattern (Clarke and Lu, 1975).

All captures were made with opening/closing trawls. Bars represent a capture and the bar length indicates the depth range of the trawl while open. Yellow bars indicate a daytime capture and blue bars a nighttime capture. Fishing effort between 1000-1250 m was about twice that between 1250 and 1500 m, and effort between 1000-1500 m was about 5 times that between 1500 and 2000 m and about the same as that between 500 and 1000 m.

Numerous records exists for captures in excess of 1200 m (e. g., see Roper and Young, 1975) from open nets. Unfortunately, due to the rather high probability of contamination from shallower depths, these records are of questionable value.

Horizontal Distribution

The vampire squid is broadly distributed throughout the depths of the world's tropical and temperate oceans. Some geographical variation has been noted. Young (1972) found that the beaks of vampire squid from the Pacific Ocean off California were distinctly smaller than those from vampires of the Gulf of Guinea in the Atlantic Ocean. He also noted differences in sucker size and gill size in vampires from these areas. Vampires from off Monterey, California have a predominance of reddish rather than black chromatophores.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Vampyroteuthis infernalis has eight long arms and two retractile filaments that can extend well past the total length of the animal and can be retracted into pockets within the web. These filaments function as sensors because of the cirri that cover the entire length of the arm with suckers only on the distal half. There are also two fins on the dorsal surface of the mantle. The vampire squid is so named because of its jet-black skin, webbing between the arms, and red eyes - supposedly characteristics of a vampire. The squid is considered small - reaching a maximum length of 28 cm with the approximate size of a football. There is sexual dimorphism in size: females are larger than males.

The vampire squid has the consistency of a jellyfish, but its most intriguing physical characteristic is that it has proportionally the largest eyes of any animal in the world. A squid six inches long will have eyes that are an in inch across which are comparable to the eye size of a full grown dog.

The vampire squid has black chromatophores with reddish-brown ones interspersed. In contrast to other cephalopods, these chromatophores are non-functional because they have lost the muscles that enable rapid color change. The vampire shares most other features with other octopods and decapods, but it has several adaptations that allow it to live in a deep-sea environment. The loss of most of the active chromatophores and the ink sac are just two examples. The vampire squid also has photophores which are large circular organs which are located posterior to each adult fin and are also distributed over the surface of the mantle, funnel, head, and aboral surface. These photoreceptors produce luminescent clouds of glowing particles that allow the vampire squid to glow.

(Grzimek 1972, Wood and Ellis 1999, Wood 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Watasella nigra Sasaki, 1920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Isopropyl Alcohol
Year Collected: 1906
Locality: Honshu Island, South Of Island, Shio Miaki Light, N 65 Deg. E, 7 Mile, Japan, North Pacific Ocean
Depth (m): 995 to 995
Vessel: Albatross R/V
  • Holotype: Sasaki, M. 1920. Proc. U.S. Natl. Mus. 57(2310): 168, pl. 23, fig 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Cirroteuthis macrope Berry, 1911
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Isopropyl Alcohol
Year Collected: 1904
Locality: Channel Islands, Santa Catalina Island, California, United States, North Pacific Ocean
Depth (m): 3864 to 4131
Vessel: Albatross R/V
  • Holotype: Berry, S. 1911. Proc. U.S. Natl. Mus. 40(1838): 589.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

The vampire squid lives in the tropical and subtropical oceans of the world at depths ranging from 300-3000m with a majority of squids living between the ranges of 1,500-2,500m. Vampire squids live in the oxygen minimum layer of the ocean where virtually no light penetrates. The vampire squid prefers a temperature between 2 and 6 degrees Celsius.

(Grzimek 1972)

Aquatic Biomes: benthic ; oceanic vent ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Bathypelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic, meso-bathypelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 223 specimens in 1 taxon.
Water temperature and chemistry ranges based on 215 samples.

Environmental ranges
  Depth range (m): 0 - 7555
  Temperature range (°C): 1.077 - 17.363
  Nitrate (umol/L): 1.724 - 44.461
  Salinity (PPS): 34.099 - 36.290
  Oxygen (ml/l): 0.303 - 6.270
  Phosphate (umol/l): 0.285 - 3.485
  Silicate (umol/l): 1.847 - 175.599

Graphical representation

Depth range (m): 0 - 7555

Temperature range (°C): 1.077 - 17.363

Nitrate (umol/L): 1.724 - 44.461

Salinity (PPS): 34.099 - 36.290

Oxygen (ml/l): 0.303 - 6.270

Phosphate (umol/l): 0.285 - 3.485

Silicate (umol/l): 1.847 - 175.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Carnivorous. The vampire squid has the lowest mass-specific metabolic rate of any cephalopod because of its decreased reliance on locomotion for escaping predators and capturing prey in the light-limited deep sea. The vampire squid uses its sensory filaments to find food in the deep sea and also has a highly developed statocyst indicating that it descends slowly and balances in the water almost effortlessly. Despite its name and reputation, Vampyroteuthis infernalis is not an agressive predator. While drifting, the squid deploys one filament at a time until one of them contacts an animal of prey. The squid then swims around in a circle hoping to catch the prey.

(Seibel, et al 1998, Wood and Ellis 1999, Wood 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behavior

Vampyroteuthis can swim surprisingly fast for a gelatinous animal. Hunt (1996) estimates from videotapes that it can reach two body lengths/sec, and it can accellerate to this speed in 5 sec. An escape reaction involves the quick movement of the fins toward the funnel followed by a jet from the mantle. This sequence is repeated as the vampire takes a series of quick turns in an erratic escape route (Hunt, 1996). The arms are sometimes spread forward to form, along with the web, an umbrella-like or bell-shaped posture while the vampire slowly swims forward (Hunt, 1996). The vampire appears to orient most commonly in a horizontal attitude with generally one filament extended (Hunt, 1996). The filaments appear to be tactile sense organs (Hunt, 1996). It has a posture ("pineapple posture") in which the arms and web are spread aborally over the head and mantle (Robison, 1995). In this posture the squid would be somewhat more difficult to injure and would be covered by a densely pigmented cloak. The oral surface of the arms and webs are the most heavily pigmented (black) regions on the animal. The posture, therefore, is probably a defensive one.

Arm tip from a preserved vampire squid showing the light emitting surface (unpigmented), as well as suckers and cirri (photograph copyright © 1999, R. E. Young).

Hunt (1966) first observed bioluminescence displays in the living animal. Fin-base photophores have been observed to glow brightly for less than a second (a flash) or longer than two minutes. In addition the light intensity can vary giving a pulsating appearance, and as light is extinguished, the glowing disc can be seen to decrease in diameter as well as intensity.

Arm-tip organs are unpigmented on their oral surface where light is emitted but otherwise do not look like luminescent structures (see photograph on the right). The photophores all glow simultaneously, or they all can flash at a rate of one to three per second or pulsate. With the arm-tip organs apparently glowing continuously, the vampire moves the arms ("arm writhing") around rapidly exposing and hiding the photophores which is "...very disorienting [to an observer] when trying to visually fix the animal's position" (Hunt, 1996 p. 104). Often a flash of the arm tips is followed by a rapid escape response. Another unusual and visually confusing effect is seen when viewing the vampire posteriorly from the mantle apex. The apparently disturbed vampire can curl the arms and web posteriorly over the head ("pineapple posture") then illuminate the arm-tip organs and the fin-base organs. "...the arm tips appear to come toward you, whereas the fin[base]lights appear to be moving away (due to their apparent shrinkage)" (Hunt, 1996, p. 104).

The third source of bioluminescence is luminescent clouds. These appear as a mucous matrix with a few hundred to over 1000 discrete, glowing particles embedded in it. The particles can glow for up to 9.5 min. The source of the particles has been shown to be the arm tip organs (Robison, et al., 2003). The latter authors suggest that flashing of the arm-tip organs is controlled by covering or exposing the photogenic region by the pigmented sides of the arm tips, that the microscopic glowing particles are not luminescent bacteria, and that the function of the bioluminescence is to startle or distract a predator.

Some spectacular videos of Vampyroteuthis bioluminescence can be seen here:

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Life Cycle

Life History

  1. Fins
    • Development of the fins in the vampire is unique among cephalopods. One pair is present at hatching and is eventually resorbed and replaced by a more anterior pair as development proceeds. At one stage in development, therefore, the vampire has two pairs of fins. The first pair to develop is the homologue of the fins of other cephalopods (Young and Vecchione, 1996). The unusual fin ontogeny is partially responsible for the early description of 3 families and many species where only one species actually exists. Except for the fins, the young vampire squid (ca 10 mm ML) have an appearance very similar to that of the adult.
  2. Eggs and hatchlings
    • Vampires lack nidamental glands and have rather small oviducal glands. As a result there is little likelihood that they produce large egg masses. Off California small vampire squid occupy greater depths than do the larger individuals (Roper and Young, 1975) suggesting that spawning occurs in very deep water. A hatchling is known from deep water off Hawaii.

Figure. The photograph shows a four-fin stage in which the adult fins are bigger than the paralarval fins. Note the mm scale. Photograph by John Bower.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Because small vampire squids occupy deeper water than larger squids, spawning probably occurs in very deep water. It is most likely that males transfer spermatophores to the female from their funnel. The female vampire squid is larger than the male and discharges the fertilized eggs directly into the water. Mature eggs are fairly large at 3-4mm in diameter and are found free-floating in small masses in deep water.

(Grzimek 1972, Young 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vampyroteuthis infernalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCPH422-07|NC_009689|Vampyroteuthis infernalis| ATGCGATGATTATTCTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTAGGTATTTGATCAGGTTTATTAGGAACATCTTTA---AGTTTAATAATTCGAACAGAGCTTGGACAACCAGGATCCTTATTAAATGAT---GATCAATTATATAATGTAATTGTAACAGCTCATGCTTTCGTTATAATTTTTTTTTTAGTAATACCTGTTATAATTGGGGGTTTTGGTAATTGACTTATCCCTTTAATA---TTAGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTACTTTATTATTAACCTCTGCTACAATTGAAAGAGGAGTTGGAACAGGATGAACTGTATATCCACCTCTTGCTAGAAATCTAGCACATACCGGGCCCTCTGTAGATTTA---GCTATTTTTTCACTTCATCTTGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACTATTATAAATATACGTTGACAAGGAATATATATAGAACGATTACCTTTATTTGTATGGTCAATTCTAATTACAACAATTTTATTACTTTTATCTATGCCTATTTTAGCTGGA---GCTATTACAATATTATTAACTGATCGAAATTTCAATACTACCTTTTTTGATCCAAGAGGTGGAGGAGACCCTATCTTATACCAACATTTATTTTGATTTTTTGGCCACCCAGAAGTATATATTTTAATTCTACCAGGATTTGGAATTATTTCTCATATTGTATCTCATTACTCTTTAAAAAAA---GAAGTTTTTGGAATATTAGGTATAATTTATGCTATAATATCTATTGGTTTACTGGGTTTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vampyroteuthis infernalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

The vampire squid and its habitat are not threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The vampire squid also does not have a negative economic benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The vampire squid has no positive economic benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Vampire squid

The vampire squid (Vampyroteuthis infernalis, lit. "vampire squid from Hell") is a small, deep-sea cephalopod found throughout the temperate and tropical oceans of the world. Unique retractile sensory filaments justify the vampire squid's placement in its own order: Vampyromorphida (formerly Vampyromorpha), which shares similarities with both squid and octopuses. As a phylogenetic relict it is the only known surviving member of its order, first described and originally classified as an octopus in 1903 by German teuthologist Carl Chun, but later assigned to a new order together with several extinct taxa.

Contents

Physical description

The vampire squid reaches a maximum total length of around 30 cm (1 ft). Its 15 cm (6 inch) gelatinous body varies in color between velvety jet-black and pale reddish, depending on location and lighting conditions. A webbing of skin connects its eight arms, each lined with rows of fleshy spines or cirri; the inside of this "cloak" is black. Only the distal half (farthest from the body) of the arms have suckers. Its limpid, globular eyes, which appear red or blue, depending on lighting, are proportionately the largest in the animal kingdom at 2.5 cm (1 inch) in diameter.[1] The animal's dark color, cloak-like webbing, and red eyes are what gave the vampire squid its name.[2]

Dorsal view
Oral view

Mature adults have a pair of small fins projecting from the lateral sides of the mantle. These fins serve as the adult's primary means of propulsion: vampire squid "fly" through the water by flapping their fins. Their beak-like jaws are white. Within the webbing are two pouches wherein the tactile velar filaments are concealed. The filaments are analogous to a true squid's tentacles, extending well past the arms; however, they are a different arm pair than the squid's tentacles. Instead, the filaments are the same pair that were lost by the ancestral octopuses.

The vampire squid is almost entirely covered in light-producing organs called photophores. The animal has great control over the organs, capable of producing disorienting flashes of light for fractions of a second to several minutes in duration. The intensity and size of the photophores can also be modulated. Appearing as small white discs, the photophores are larger and more complex at the tips of the arms and at the base of the two fins, but are absent from the underside of the caped arms. Two larger white areas on top of the head were initially believed to also be photophores, but have turned out to be photoreceptors.

The chromatophores (pigment organs) common to most cephalopods are poorly developed in the vampire squid. While this means the animal is not capable of changing its skin colour in the dramatic fashion of shallow-dwelling cephalopods, such trickery is not needed at the lightless depths where it lives.

Habitat and adaptations

The vampire squid is an extreme example of a deep-sea cephalopod, thought to reside at aphotic (lightless) depths from 600–900 metres (2,000–3,000 feet) or more. Within this region of the world's oceans is a discrete habitat known as the oxygen minimum zone (OMZ). Within the OMZ oxygen saturation is too low to support aerobic metabolism in most higher organisms. Nonetheless, the vampire squid is able to live and breathe normally in the OMZ at oxygen saturations as low as 2%; a feat no other cephalopod, and few other animals, can claim.

To cope with life in the suffocating depths, vampire squid have developed several radical adaptations. Of all deep-sea cephalopods, their mass-specific metabolic rate is the lowest. Their blue blood's hemocyanin binds and transports oxygen more efficiently than in other cephalopods,[3] aided by gills with especially large surface area. The animals have weak musculature but maintain agility and buoyancy with little effort thanks to sophisticated statocysts (balancing organs akin to a human's inner ear)[4] and ammonium-rich gelatinous tissues closely matching the density of the surrounding seawater.

At the shallower end of the vampire squid's vertical range, the view from below is like the sky at twilight: The highly sensitive eyes of deepwater denizens are able to distinguish the silhouettes of other animals moving overhead. To combat this, the vampire squid generates its own bluish light (bioluminescence) in a strategy called counterillumination: The light diffuses the animal's silhouette, effectively "cloaking" its presence from the watchful eyes below. Its own large eyes detect even the faintest of gleams. A pair of photoreceptors are located on top of its head, perhaps alerting the animal to movements above.

Like many deep-sea cephalopods, vampire squid lack ink sacs. If threatened, instead of ink, a sticky cloud of bioluminescent mucus containing innumerable orbs of blue light is ejected from the arm tips. This luminous barrage, which may last nearly 10 minutes, is presumably meant to daze would-be predators and allow the vampire squid to disappear into the blackness without the need to swim far. The display is made only if the animal is very agitated; regenerating the mucus is costly from a metabolic point of view.

Development

Dissected adult (centre) and two immature specimens

Few specifics are known regarding the ontogeny of the vampire squid. Their development progresses through three morphologic forms: the very young animals have a single pair of fins, an intermediate form has two pairs, and the mature form again has one. At their earliest and intermediate phases of development, there is a pair of fins located near the eyes; as the animal develops, this pair gradually disappears as the other pair develops.[5] As the animals grow and their surface area to volume ratio drops, the fins are resized and repositioned to maximize gait efficiency. Whereas the young propel themselves primarily by jet propulsion, mature adults find flapping their fins to be the most efficient means (Seibel et al. 1998). This unique ontogeny caused confusion in the past, with the varying forms identified as several species in distinct families (Young 2002).

If hypotheses may be drawn from knowledge of other deep-sea cephalopods, the vampire squid likely reproduces slowly by way of a small number of large eggs. Growth is slow as nutrients are not abundant at depths frequented by the animals. The vastness of their habitat and its sparse population make procreative encounters a fortuitous event. The female may store a male's hydraulically implanted spermatophore (a tapered, cylindrical satchel of sperm) for long periods before she is ready to fertilize her eggs. Once she does, she may need to brood over them for up to 400 days before they hatch. The female will not eat towards this culmination and dies shortly thereafter.

Hatchlings are c. 8 mm in length and are well-developed miniatures of the adults, with some differences. Their arms lack webbing, their eyes are smaller and their velar filaments are not fully formed. The hatchlings are transparent and survive on a generous internal yolk for an unknown period before they begin to actively feed. The smaller animals frequent much deeper waters, perhaps feeding on marine snow (falling organic detritus).

Behavior

What behavioural data known has been gleaned from ephemeral encounters with ROVs; animals are often damaged during capture and survive for no more than about two months in aquaria. An artificial environment makes reliable observation of non-defensive behaviour difficult.

With their long velar filaments deployed, vampire squid have been observed drifting along in the deep, black ocean currents. If the filaments contact an entity, or if vibrations impinge upon them, the animals investigate with rapid acrobatic movements. They are capable of swimming at speeds equivalent to two body lengths per second, with an acceleration time of five seconds. However, their weak muscles limit stamina considerably.

Unlike their relatives living in more hospitable climes, deep-sea cephalopods cannot afford to expend energy in protracted flight. Given their low metabolic rate and the low density of prey at such depths, vampire squid must use innovative predator avoidance tactics to conserve energy. Their aforementioned bioluminescent "fireworks" are combined with the writhing of glowing arms, erratic movements and escape trajectories, making it difficult for a predator to home in.

In a threat response called "pumpkin" or "pineapple posture", the vampire squid inverts its caped arms back over the body, presenting an ostensibly larger form covered in fearsome-looking though harmless spines (called cirri).[6] The underside of the cape is heavily pigmented, masking most of the body's photophores. The glowing arm tips are clustered together far above the animal's head, diverting attack away from critical areas. If a predator were to bite off an arm tip, the vampire squid can regenerate it.

Copepods, prawns and cnidarians have all been reported as prey of vampire squid. Little else is known regarding their feeding habits, but considering their environment, they are likely to be opportunists. Vampire squid have been found among the stomach contents of large deepwater fish such as giant grenadiers,[7] and deep diving mammals such as whales and sea lions.

Relationships

Pyritized fossil of Vampyronassa rhodanica from the Lower Callovian of La Voulte-sur-Rhône.

The Vampyromorphida are characterized by such apomorphies as the possession of photophores, a peculiar type of uncalcified endoskeleton (the gladius), eight webbed arms and the two velar filaments. Until fairly recently known only from the modern species and some fossil remains tentatively allocated to this group, a batch of Middle Jurassic (Lower Callovian, c.165–164 mya) specimens found at La Voulte-sur-Rhône demonstrated that clearly vampyromorphid cephalopods were in existence for far longer than has been hitherto believed.

These were described as Vampyronassa rhodanica. The supposed vampyromorphids from the Kimmeridgian-Tithonian (156–146 mya) of Solnhofen, Plesioteuthis prisca, Leptoteuthis gigas, and Trachyteuthis hastiformis, cannot be positively assigned to this group; they are large species (from 35 cm in P. prisca to > 1 meter in L. gigas) and show features not found in vampyromorphids, being somewhat similar to the true squids, Teuthida.[8]

Symbolism

A 2010 Rolling Stone article[9] by Matt Taibbi likened investment bank Goldman Sachs to "a great vampire squid wrapped around the face of humanity, relentlessly jamming its blood funnel into anything that smells like money."[9] This comparison was later used by other critics of Goldman Sachs, such as the Occupy Wall Street movement.[10]

Notes

  1. ^ Ellis, Richard. "Introducing Vampyroteuthis infernalis, the vampire squid from Hell". The Cephalopod Page. Dr. James B. Wood. http://www.thecephalopodpage.org/vsfh.php. Retrieved 27 April 2012. 
  2. ^ Seibel, Brad. "Vampyroteuthis infernalis, Deep-sea Vampire squid". The Cephalopod Page. Dr. James B. Wood. http://www.thecephalopodpage.org/vampy.php. Retrieved 3 July 2011. 
  3. ^ Seibel et al. 1999
  4. ^ Stephens, P. R.; Young, J. Z. (2009). "The statocyst of Vampyroteuthis infernalis (Mollusca: Cephalopoda)". Journal of Zoology 180 (4): 565–588. doi:10.1111/j.1469-7998.1976.tb04704.x.  edit
  5. ^ Pickford 1949
  6. ^ "Vampire Squid Turns "Inside Out"". National Geographic. February 2010. http://news.nationalgeographic.com/news/2010/01/100203-squid-vampire-threatened-video/. Retrieved June 2011. 
  7. ^ Drazen, Jeffrey C; Buckley, Troy W; Hoff, Gerald R (2001). "The feeding habits of slope dwelling macrourid fishes in the eastern North Pacific". Deep Sea Research Part I: Oceanographic Research Papers 48 (3): 909–935. doi:10.1016/S0967-0637(00)00058-3. 
  8. ^ Fischer & Riou 2002
  9. ^ a b By Matt Taibbi (2010-04-05). "The Great American Bubble Machine | Politics News". Rolling Stone. http://www.rollingstone.com/politics/news/the-great-american-bubble-machine-20100405. Retrieved 2012-01-04. 
  10. ^ Roose, Kevin (2011-12-13). "The Long Life of the Vampire Squid - NYTimes.com". Dealbook.nytimes.com. http://dealbook.nytimes.com/2011/12/13/the-long-life-of-the-vampire-squid-metaphor/. Retrieved 2012-01-04. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!