Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Comprehensive Description

[32] Anochetus grandidieri HNS

The small African species related to A. grandidieri HNS were multiplied mercilessly by Santschi and Bernard. These forms have short, stout mandibles and small, but not minute eyes (worker EL 0.07-0.12 mm), and the antennal scapes usually fail to réach the posterior corners of the head; funicular segments II, III, IV short, hardly longer than broad. The petiolar node is narrow in side view and tapered apicad to a sharp, or at least very narrow apex; in front view, the petiolar margin varies from convex to emarginate, and is often merely flattened in the middle. The vertex, pronotal disc and gastric dorsum are mostly smooth and shining, with spaced punctures of varying coarseness.

Only in A. grandidieri HNS of Madagascar do the frontal striae reach far back on the vertex, where they overrun some of the punctures and surround the front and sides of the posteromedian impression. This is the commonly-collected small Anochetus HNS of Madagascar in leaf litter and forest soil, including the soil about the roots of epiphytes: Andasibé (= Périnet ), 950-980 mm, several collections in forest, March 1969 and February 1977; W. L. and D. E. Brown; Imerintsiatosika, about 34 km W of Tananarive, pasture with eucalyptus, W. L. Brown; above Sakaramy on road to Joffreville, 500 m, litter of disturbed forest, Browns; 84 km SW Sambava on road to Andapa, disturbed forest, Browns. 8 km W of Maroantsetra, degraded forest with vanilla, Browns.

M. A. Peyrieras has found this species in forest litter and humus berlesates from: Causse de Kelifely, west-central Madagascar, litter of dry limestone forest; route d’Anosibé (from Moramanga); Beforona, 500 m.

A. madecassus HNS is just the queen of grandidieri HNS . The only other Anochetus HNS at present known from Madagascar is A. madagascarensis HNS [29], also represented by repeated collections.

On the African mainland, the grandidieri HNS complex groups into two entities that differ by minor, but possibly constant characters. One of these entities occurs in the eastern Cape Province of South Africa, where it corresponds to the type of A. punctaticeps HNS , the first name available for it. This form is concolorous ferruginous yellow and has a smooth and shining first gastric tergum, with only fine and inconspicuous punctures; the propodeal angles are low and obtuse, and the petiolar node as seen from the side tapers to a narrowly-rounded apex (fig. 20). The type locality of A. punctaticeps HNS is Port Elizabeth, eastern Cape Province. I took samples at Walmer, a western suburb of Port Elizabeth, in thin eucalypt litter along a roadside strip; at Alexandria Forest, near Alexandria; at Beggar’s Bush, near Grahamstown, in ravine forest; and on Signal Hill, near Grahamstown, under a rock in thin forest.

In eastern, central and western sub-Saharan Africa, panctaticeps is replaced by a rather common, more variable form, corresponding to a group of available names, the earliest of which is A. grandidieri var. katonae Forel HNS 1907, so that I am calling the species A. katonae HNS . The types of the worker-based species and varieties concinms, punctatus HNS , punctatus var. occidentalis HNS , lampttei and gnomulus HNS all seem to be minor variants of this same species. The type of A. parvus HNS is missing from its mount and presumably lost, but there is nothing about its description to suggest that it belongs to a different species. A. parvus var. longiceps HNS is based partly on a queen from Cameroun, so I cannot be sure that it is not one of the species with minute worker eyes, such as siphneus HNS , but in the absence of queen samples of siphneus HNS there appears to be no way to decide this problem; I am provisionally listing longiceps HNS as a synonym of katonae HNS .

  • Brown, WL Jr., (1978): Contributions toward a reclassification of the Formicidae. Part VI. Ponerinae, tribe Ponerini, subtribe Odontomachiti. Section B. Genus Anochetus and bibliography. Studia Entomologica 20, 549-638: 606-607, URL:http://antbase.org/ants/publications/6757/6757.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anochetus grandidieri Forel HNS

Figures: worker 3a-d, 5c; queen 3e-h; male 3i-j, 8b; map 6b

Type material:

Anochetus grandidieri Forel, 1891 HNS : 108 [ 21 ] . Lectotype: worker, Madagascar , Forest of the east coast ( M. Humblot ) ( MHNG ), present designation [examined], AntWeb CASENT0101819 . Brown, 1978: 606 [ 2 ] (description of worker) .

Anochetus madecassus Santschi, 1928 HNS : 54 [ 22 ] . Lectotype: dealate queen, Madagascar , Nossi-Be( Descarpentries ) ( NHMB ) Lectotype by present designation [examined] AntWeb CASENT0101098 . Synonymized with grandidieri HNS by Brown, 1978 : 557 [ 2 ].

Worker measurements: maximum and minimum based on all specimens, n = 20. HL 0.79-1.19, HW 0.71-1.06, CI 85-95, EL 0.08-0.13, ML 0.33-0.57, MI 41-54, SL 0.57-0.88, SI 78-86, WL 0.87-1.35, FL 0.57-0.90, PW 0.44-0.62.

Figure 8. Anochetus HNS males, terminalia, lateral view. A, boltoni HNS CASENT0063847. B, grandidieri HNS CASENT0080660. B, madagascarensis HNS CASENT0063421. D, pattersoni HNS CASENT0172617. doi:10.1371/journal.pone.0001787.g008

Figure 9. NJ tree of K2P for five species of Anochetus HNS in Madagascar, Comoros and Aldabra (all specimens with.500 bp). Deep divergences evident between madagascarensis HNS , grandidieri HNS , and goodmani HNS are evident. Deep divergences within A. goodmani HNS are evident (In this tree, A. boltoni HNS falls within goodmani HNS ). The rightmost column of colors differentiate which biogeographical groupings of Wilme et al. [ 29 ] these populations fall. WCE-1 = Binara, Antsahabe. WCE-12 = Andavakoera, Ankarana. WCE-7= Kirindy Mite. WRDW-B = Vazimba, Androngonibe, Andranopasazy. doi:10.1371/journal.pone.0001787.g009

Table 2. Anochetus goodmani HNS within-species pair-wise partitioning of genetic variance for the CO1 DNA barcode. K2P distances are beneath the diagonal and the number substitutions are above the diagonal.

Table 3. Comparison of the utility of various complimentary nuclear markers for species diagnosis in the ponerine ants of the Malagasy.

Taxa 18S 28S ITS1 Comments
Anochetus goodmani HNS Intra - no variation. nter - 2 bp from A. boltoni HNS , and 3 bp from O. troglodytes HNS , O. coquereli HNS Intra - no variation across north nter -.15 bp divergent from A. madagascarensis HNS . Intra - extreme variation (length and substitution) across range. Some corresponding to deep CO1 splits - provisionally orthologous. However, deep paralogous divergences have been sequenced within single individuals through different amplifications and extractions. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning.
Anochetus boltoni HNS Intra - no variation. nter - 2 bp from A. goodmani HNS , 2 bp from O. troglodytes HNS and no difference from O. coquereli HNS . N/A Intraspecific variation of 1% (indels and substitutions) between the two sampled populations.
Anochetus madagascarensis HNS N/A Intra - no variation. nter -.15 bp divergent from A. goodmani HNS . Intra - variation that does NOT reflect CO1 variation. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. -Positive Wolbachia test.
Anochetus grandidieri HNS N/A N/A Low iIntraspecific variation that does reflect CO1 geographic variation. - Positive Wolbachia test.
Anochetus pattersoni HNS N/A N/A N/A
Odontomachus coquereli HNS Intra - no variation. nter - 2 bp from O. troglodytes HNS . 2bp from A. boltoni HNS ,and 3 bp from A. goodmani HNS . Intra - variation. Large variation at geographically distal ends of distribution. nter - differentiates between three Malagasy species. Intraspecific variation that only partially reflects geography and CO1 variation - while some clearly does not. Paralogous and orthologous
Odontomachus troglodytes HNS Intra - no variation. nter - 2 bp from O. coquereli HNS . 3 bp from A. boltoni HNS ,and3bp from A. goodmani HNS . Intra - some variation that does not correspond to geography or CO1. nter - does not differentiate between O. simillimus HNS Intraspecific variation that only partially reflects geography and CO1 variation All specimens tested positive for Wolbachia.
Odontomachus simillimus HNS N/A Intra - no variation. nter - does not differentiate O. troglodytes HNS N/A

doi:10.1371/journal.pone.0001787.t003

Queen measurements: maximum and minimum based on n = 5. HL 0.88-1.15, HW 0.81-1.07, CI 92-96, EL 0.17-0.23, ML 0.39-0.56, MI 44-49, SL 0.62-0.87, SI 77-81, WL 1.08- 1.46. FL 0.68-0.96, PW 0.60-0.78.

Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.58-0.73, HW 0.78-0.94, CI 129- 135, EL 0.37-0.46, SL 0.10-0.15, SI 13-16, WL 1.17-1.52, FL 0.78-1.08

Worker diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05-0.11 mm), projecting dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and sculpture as in Figures 3 a-d.

Queens alate: Very similar to workers, only slightly larger than respective size class (Figs 3e-h). Ergatoid queens not recorded.

Within a single locality, two size classes of workers, queens and males are present in this species, but the differences within a site do not hold up when variation across all sites is included. These differences suggest that two reproductive and developmental pathways can occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger the development of small and large castes.

The species is most similar to A. madagascarensis HNS but can be easily distinguished by its small eyes and scape that does not surpass the occipital lobe. A. madagascarensis HNS has large eyes (0.24-0.26 mm), and scapes that surpass occipital lobes.

Distribution and biology. A. grandidieri HNS is endemic to Madagascar and is widespread throughout Madagascar in forest and shrubland habitats below 1,550 m elevation (Fig 4b). It has been collected in gallery, dry, littoral, lowland, and montane forest, in desert spiny bush thicket in the southwest, and Uapaca woodland in the ceIntral plateau. As in many soil dwelling ants, A. grandidieri HNS has reduced eyes (EL/HW 0.11-0.13) and short scapes . A. grandidieri HNS is the only Anochetus HNS in Madagascar with these soil nesting modifications. The subterranean habitat of this species may allow it to survive in a wide range of habitats in Madagascar from desert to woodland to montane forest. Out of 453 collecting events, A. grandidieri HNS was most often recorded in sifted litter (97 collection records), rotten logs (96), and Malaise traps (155).

CO1. Shallow iIntraspecific (average within species sequence divergence of 2.72, SE = 0.048) and deep interspecific divergences(9.4% SE = 0.05) between A. grandidieri HNS and the other species. Small and large castes had identical DNA barcodes. (Figs 9, 16).

Diagnostic barcoding loci. A grandidieri HNS : T-273, T-282, T- 306, A-312, (shared with one population of A. goodmani HNS ), A-312, T- 333, A-483, T-528 (all 3rd base pair positions).

Specimens examined for Anochetus grandidieri HNS : Specimens from 456 separate collection events from the following 140 localities were examined. MADAGASCAR : Province Antsiranana : Sakalava Beach ; Montagne des Francais , 7.2 km 142° SE Antsiranana ; Antsiranana II Pref: Antsahampano S.-Pref : Montagne d'Ambre. Site MD2 ; Parc National Montagne d'Ambre , 3.6 km 235° SW Joffreville ; Reserve Speciale de l'Ankarana , 13.6 km 192° SSW Anivorano Nord ; Foret d'Ampondrabe , 26.3 km 10° NNE Daraina ; Foret d' Antsahabe , 11.4 km 275° W Daraina ; Foret de Binara , 7.5 km 230° SW Daraina ; Foret de Binara , 9.1 km 233° SW Daraina ; Nosy Be , Lokobe Forest ; Foret Ambato , 26.6 km 33° Ambanja ; Ambondrobe , 41.1 km 175° Vohemar ; Ampasindava, Foret d'Ambilanivy , 3.9 km 181° SAmbaliha ; R.S. Manongarivo , 10.8 km 229° SW Antanambao ; R.S. Manongarivo , 12.8 km 228° SW Antanambao ; R.S. Manongarivo , 14.5 km 220° SW Antanambao ; Foret d'Anabohazo , 21.6 km 247° WSW Maromandia ; Parc National de Marojejy , Manantenina River , 27.6 km 35° NE Andapa , 9.6 km 327° NNW Manantenina ; Parc National de Marojejy, Manantenina River , 28.0 km 38° NE Andapa , 8.2 km 333° NNW Manantenina ; Parc National Marojejy ; Marojejy R.N.I. #12 ; Foret Ambanitaza , 26.1km 347° Antalaha ; 9.2 km WSW Befingotra , Res. Anjanaharibe-Sud ; 6.5 km SSW Befingotra , Res. Anjanaharibe-Sud ; 17 km W Andapa , Res. d' Anjanaharibe-Sud ; 5 km SW Antalaha ; 14 km W Cap Est , Ambato ; Fotodriana , Cap Masoala . Province Mahajanga : Mahavavy River , 6.2 km 145° SE Mitsinjo ; Reserve d'Ankoririka , 10.6 km 13° NE de Tsaramandroso ; Ampijoroa National Park , 160 km N Maevatanana , Mahajanga Prov ., deciduous forest ; Parc National de Namoroka , 17.8 km 329° WNW Vilanandro ; Parc National de Namoroka , 16.9 km 317° NW Vilanandro ; Parc National de Namoroka , 9.8 km 300° WNW Vilanandro ; Reserve Speciale de Bemarivo , 23.8 km 223° SW Besalampy ; Parc National Tsingy de Bemaraha , 10.6 km ESE 123° Antsalova ; Foret de Tsimembo , 8.7 km 336° NNW Soatana ; Parc National Tsingy de Bemaraha , 2.5 km 62° ENE Bekopaka , Ankidrodroa River ; Parc National Tsingy de Bemaraha , 3.4 km 93° E Bekopaka , Tombeau Vazimba ; Province Toamasina : Montagne d'Anjanaharibe , 19.5 km 27° NNE Ambinanitelo ; Montagne d'Anjanaharibe , 18.0 km 21 ° NNE Ambinanitelo ; Montagne d'Akirindro 7.6 km 341 ° NNW Ambinanitelo ; 19 km ESE Maroantsetra ; 6.9 km NE Ambanizana , Ambohitsitondroina ; Ambanizana , Parc National Masoala ; 5.3 km SSE Ambanizana , Andranobe ; 6.3 km S Ambanizana , Andranobe ; 1 km W Andampibe , Cap Masoala ; Parc National Mananara-Nord , 7.1 km 261° Antanambe ; Foret d'Analava Mandrisy , 5.9 km 195° Antanambe ; Res. Ambodiriana , 4.8 km 306° Manompana , along Manompana River ; Ile Sainte Marie , Foret Ambohidena , 22.8 km 44° Ambodifotatra ; Ile Sainte Marie , Foret Kalalao , 9.9 km 34° Ambodifotatra ; Parcelle E3 Tampolo ; S.F. Tampolo, 10 km NNE Fenoarivo Atn . ; Bridge at Onibi , NW of Mahavelona ; Mahavelona ( Foulpointe ) ; 2.1 km 315° Mahavelona ; Foulpointe ; Reserve Betampona , Camp Vohitsivalana , 37.1 km 338° Toamasina ; Reserve Betampona , Camp Rendrirendry 34.1 km 332° Toamasina ; F.C. Sandranantitra ; F.C. Didy ; F.C. Andriantantely ; P.N. Mantadia ; Analamay ; Foret Ambatovy , 14.3 km 57° Moramanga ; Torotorofotsy ; Andasibe National Park , botanic garden near eIntrance, West of ANGAP office ; Res. Analamazaotra , Parc National , Andasibe ; Fianarantsoa : Foret d'Atsirakambiaty, 7.6 km 285° WNW Itremo ; Ranomafana Nat. Park , Miaranony Forest ; Vohiparara broken bridge , Fianarantsoa Prov . ; Parc National de Ranomafana , Sahamalaotra River , 6.6 km 310° NW Ranomafana ; Parc Nationale Ranomafana : Talatakely ; 3 km W Ranomafana , nr. Ifandiana ; research cabin at Talatakely , Ranomafana National Park ; radio tower, Ranomafana National Park , Fianarantsoa Prov . ; Namorona River at footbridge, Ranomafana National Park ; Ranomafana National Park , Tavolo tree ; Belle Vue trail , Ranomafana National Park , Fianarantsoa Prov . ; 7 km W Ranomafana ; Vatoharanana ; Parc National deRanomafana , Vatoharanana River , 4.1 km 231 ° SW Ranomafana ; P.N. Ranomafana , Vatoharanana-Ankovoka ; 8 km E Kianjavato , Vatovavy Forest ; 7.6 km 122° Kianjavato , Foret Classee Vatovavy ; 2 km W Andrambovato , along river Tatamaly ; Foret d'Ambalagoavy Nord , Ikongo , Ambatombe ; 45 km S. Ambalavao ; 45 km S Ambalavao ; 43 km S Ambalavao , Res. Andringitra ; Parc National d'Isalo , Ambovo Springs , 29.3 km 4° N Ranohira ; 8.0 km NE Ivohibe ; 9.0 km NE Ivohibe ; R.S. Ivohibe , 7.5 km ENE Ivohibe ; Parc National d'Isalo , 9.1 km 354° N Ranohira ; Foret d'Analalava , 29.6 km 280° W Ranohira ; Foret de Vevembe , 66.6 km 293° Farafangana ; Province Toliara : Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 34.6 km 314° NW Ambaravaranala ; Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 35.2 km 312° NW Ambaravaranala ; Vohibasia Forest , 59 km NE Sakaraha ; southern Isoky-Vohimena Forest , 59 km NE Sakaraha ; Foret Classee d'Analavelona , 33.2 km 344° NNW Mahaboboka ; Foret Classee d'Analavelona , 29.2 km 343° NNW Mahaboboka ; Foret Classee d'Analavelona , 29.4 km 343° NNW Mahaboboka ; Foret de Tsinjoriaky , 6.2 km 84° E Tsifota ; Parc National de Zombitse , 19.8 km 84° E Sakaraha ; Parc National de Zombitse , 17.7 km 98° E Sakaraha ; 15 km E Sakaraha ; Foret de Mite , 20.7 km 29° WNW Tongobory ; Sept Lacs; Beza-Mahafaly, 27 km E Betioky ; Ehazoara Canyon , 26 km E Betioky ; 70.7 km NNE Tolanaro , Mahermano Mt .; 11 km NW Enakara , Res. Andohahela ; 10 km NW Enakara , Res. Andohahela ; Res . Andohahela , 6 km SSW Eminiminy ; Parc National d'Andohahela , Col du Sedro , 3.8 km 113° ESE Mahamavo , 37.6 km 341° NNW Tolagnaro ; Parc National d'Andohahela , Manampanihy River , 5.4 km 113° ESE Mahamavo , 36.7 km 343° NNW Tolagnaro ; 2.7 km WNW 302° Ste. Luce ; 9.2 km N Tolanaro , Ilapany Mt . ; 29.5 km WNW Tolanaro , Vasiha Mt . ; Parc National d'Andohahela , Foret d'Ambohibory , 1.7 km 61° ENE Tsimelahy , 36.1 km 308° NW Tolagnaro ; Mandena , 8.4 km NNE 30° Tolagnaro ; Reserve Prive Berenty , Foret de Bealoka , Mandrare River , 14.6 km 329° NNW Amboasary ; Reserve Prive Berenty , Foret de Malaza , Mandrare River , 8.6 km 314° NW Amboasary ; Reserve Berenty; Foret de Petriky , 12.5 km W 272° Tolagnaro ; 4.4 km 148° SSE Lavanono ; Reserve Speciale de Cap Sainte Marie , 14.9 km 261° W Marovato ; near road, Zombitse National Park , Tulear Prov .; near ANGAP office, ZombitseNational Park , Tulear Prov .; Parcel I, Beza Mahafaly Reserve , near research station, Tulear Province ; Tsimelahy - Parcel II , Andohahela National Park , transition forest, Tulear Province .

  • Fisher, B. L., Smith, M. A. (2008): A revision of Malagasy species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae). PLoS ONE 3, 1-23: 8-11, URL:http://hdl.handle.net/10199/15447
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Anochetus grandidieri Forel, 1891c PDF: 108, pl. 3, fig. 9 (w.) MADAGASCAR. AntCat AntWiki

Taxonomic history

Senior synonym of Anochetus madecassus: Brown, 1978c: 557.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Fisher, B. L., 2008:
  Figures: worker 3a-d, 5c; queen 3e-h; male 3i-j, 8b; map 6b
  Worker measurements: maximum and minimum based on all specimens, n = 20. HL 0.79-1.19, HW 0.71-1.06, CI 85-95, EL 0.08-0.13, ML 0.33-0.57, MI 41-54, SL 0.57-0.88, SI 78-86, WL 0.87-1.35, FL 0.57-0.90, PW 0.44-0.62.
  Taxa 18S 28S ITS1 Comments Anochetus goodmani Intra - no variation. nter - 2 bp from A. boltoni , and 3 bp from O. troglodytes , O. coquereli Intra - no variation across north nter -.15 bp divergent from A. madagascarensis . Intra - extreme variation (length and substitution) across range. Some corresponding to deep CO1 splits - provisionally orthologous. However, deep paralogous divergences have been sequenced within single individuals through different amplifications and extractions. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. Anochetus boltoni Intra - no variation. nter - 2 bp from A. goodmani , 2 bp from O. troglodytes and no difference from O. coquereli . N/A Intraspecific variation of 1% (indels and substitutions) between the two sampled populations. Anochetus madagascarensis N/A Intra - no variation. nter -.15 bp divergent from A. goodmani . Intra - variation that does NOT reflect CO1 variation. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. -Positive Wolbachia test. Anochetus grandidieri N/A N/A Low iIntraspecific variation that does reflect CO1 geographic variation. - Positive Wolbachia test. Anochetus pattersoni N/A N/A N/A Odontomachus coquereli Intra - no variation. nter - 2 bp from O. troglodytes . 2bp from A. boltoni ,and 3 bp from A. goodmani . Intra - variation. Large variation at geographically distal ends of distribution. nter - differentiates between three Malagasy species. Intraspecific variation that only partially reflects geography and CO1 variation - while some clearly does not. Paralogous and orthologous Odontomachus troglodytes Intra - no variation. nter - 2 bp from O. coquereli . 3 bp from A. boltoni ,and3bp from A. goodmani . Intra - some variation that does not correspond to geography or CO1. nter - does not differentiate between O. simillimus Intraspecific variation that only partially reflects geography and CO1 variation All specimens tested positive for Wolbachia. Odontomachus simillimus N/A Intra - no variation. nter - does not differentiate O. troglodytes N/A
  Queen measurements: maximum and minimum based on n = 5. HL 0.88-1.15, HW 0.81-1.07, CI 92-96, EL 0.17-0.23, ML 0.39-0.56, MI 44-49, SL 0.62-0.87, SI 77-81, WL 1.08- 1.46. FL 0.68-0.96, PW 0.60-0.78.
  Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.58-0.73, HW 0.78-0.94, CI 129- 135, EL 0.37-0.46, SL 0.10-0.15, SI 13-16, WL 1.17-1.52, FL 0.78-1.08
  Worker diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05-0.11 mm), projecting dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and sculpture as in Figures 3 a-d.
  Queens alate: Very similar to workers, only slightly larger than respective size class (Figs 3e-h). Ergatoid queens not recorded.
  Within a single locality, two size classes of workers, queens and males are present in this species, but the differences within a site do not hold up when variation across all sites is included. These differences suggest that two reproductive and developmental pathways can occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger the development of small and large castes.
  The species is most similar to A. madagascarensis but can be easily distinguished by its small eyes and scape that does not surpass the occipital lobe. A. madagascarensis has large eyes (0.24-0.26 mm), and scapes that surpass occipital lobes.
  Distribution and biology. A. grandidieri is endemic to Madagascar and is widespread throughout Madagascar in forest and shrubland habitats below 1,550 m elevation (Fig 4b). It has been collected in gallery, dry, littoral, lowland, and montane forest, in desert spiny bush thicket in the southwest, and Uapaca woodland in the ceIntral plateau. As in many soil dwelling ants, A. grandidieri has reduced eyes (EL/HW 0.11-0.13) and shortscapes . A. grandidieri is the only Anochetus in Madagascar with these soil nesting modifications. The subterranean habitat of this species may allow it to survive in a wide range of habitats in Madagascar from desert to woodland to montane forest. Out of 453 collecting events, A. grandidieri was most often recorded in sifted litter (97 collection records), rotten logs (96), and Malaise traps (155).
  CO1. Shallow iIntraspecific (average within species sequence divergence of 2.72, SE = 0.048) and deep interspecific divergences(9.4% SE = 0.05) between A. grandidieri and the other species. Small and large castes had identical DNA barcodes. (Figs 9, 16).
  Diagnostic barcoding loci. A grandidieri : T-273, T-282, T- 306, A-312, (shared with one population of A. goodmani ), A-312, T- 333, A-483, T-528 (all 3rd base pair positions).
  Specimens examined for Anochetus grandidieri : Specimens from 456 separate collection events from the following 140 localities were examined.MADAGASCAR : Province Antsiranana : Sakalava Beach ;Montagne des Francais , 7.2 km 142° SE Antsiranana ;Antsiranana II Pref: Antsahampano S.-Pref : Montagne d'Ambre. Site MD2 ;Parc National Montagne d'Ambre , 3.6 km 235° SW Joffreville ;Reserve Speciale de l'Ankarana , 13.6 km 192° SSW Anivorano Nord ;Foret d'Ampondrabe , 26.3 km 10° NNE Daraina ;Foret d' Antsahabe , 11.4 km 275° W Daraina ;Foret de Binara , 7.5 km 230° SW Daraina ;Foret de Binara , 9.1 km 233° SW Daraina ;Nosy Be , Lokobe Forest ;Foret Ambato , 26.6 km 33° Ambanja ;Ambondrobe , 41.1 km 175° Vohemar ;Ampasindava, Foret d'Ambilanivy , 3.9 km 181° SAmbaliha ;R.S. Manongarivo , 10.8 km 229° SW Antanambao ;R.S. Manongarivo , 12.8 km 228° SW Antanambao ;R.S. Manongarivo , 14.5 km 220° SW Antanambao ;Foret d'Anabohazo , 21.6 km 247° WSW Maromandia ;Parc National de Marojejy , Manantenina River , 27.6 km 35° NE Andapa , 9.6 km 327° NNW Manantenina ;Parc National de Marojejy, Manantenina River , 28.0 km 38° NE Andapa , 8.2 km 333° NNW Manantenina ;Parc National Marojejy ;Marojejy R.N.I. #12 ;Foret Ambanitaza , 26.1km 347° Antalaha ;9.2 km WSW Befingotra , Res. Anjanaharibe-Sud ;6.5 km SSW Befingotra , Res. Anjanaharibe-Sud ;17 km W Andapa , Res. d' Anjanaharibe-Sud ;5 km SW Antalaha ;14 km W Cap Est , Ambato ;Fotodriana , Cap Masoala .Province Mahajanga : Mahavavy River , 6.2 km 145° SE Mitsinjo ;Reserve d'Ankoririka , 10.6 km 13° NE de Tsaramandroso ;Ampijoroa National Park , 160 km N Maevatanana , Mahajanga Prov ., deciduous forest ;Parc National de Namoroka , 17.8 km 329° WNW Vilanandro ;Parc National de Namoroka , 16.9 km 317° NW Vilanandro ;Parc National de Namoroka , 9.8 km 300° WNW Vilanandro ;Reserve Speciale de Bemarivo , 23.8 km 223° SW Besalampy ;Parc National Tsingy de Bemaraha , 10.6 km ESE 123° Antsalova ;Foret de Tsimembo , 8.7 km 336° NNW Soatana ;Parc National Tsingy de Bemaraha , 2.5 km 62° ENE Bekopaka , Ankidrodroa River ;Parc National Tsingy de Bemaraha , 3.4 km 93° E Bekopaka , Tombeau Vazimba ;Province Toamasina : Montagne d'Anjanaharibe , 19.5 km 27° NNE Ambinanitelo ;Montagne d'Anjanaharibe , 18.0 km 21 ° NNE Ambinanitelo ;Montagne d'Akirindro 7.6 km 341 ° NNW Ambinanitelo ;19 km ESE Maroantsetra ;6.9 km NE Ambanizana , Ambohitsitondroina ;Ambanizana , Parc National Masoala ;5.3 km SSE Ambanizana , Andranobe ;6.3 km S Ambanizana , Andranobe ; 1 km W Andampibe , Cap Masoala ;Parc National Mananara-Nord , 7.1 km 261° Antanambe ;Foret d'Analava Mandrisy , 5.9 km 195° Antanambe ;Res. Ambodiriana , 4.8 km 306° Manompana , along Manompana River ;Ile Sainte Marie , Foret Ambohidena , 22.8 km 44° Ambodifotatra ;Ile Sainte Marie , Foret Kalalao , 9.9 km 34° Ambodifotatra ;Parcelle E3 Tampolo ;S.F. Tampolo, 10 km NNE Fenoarivo Atn . ;Bridge at Onibi , NW of Mahavelona ;Mahavelona ( Foulpointe ) ;2.1 km 315° Mahavelona ;Foulpointe ;Reserve Betampona , Camp Vohitsivalana , 37.1 km 338° Toamasina ;Reserve Betampona , Camp Rendrirendry 34.1 km 332° Toamasina ;F.C. Sandranantitra ;F.C. Didy ;F.C. Andriantantely ;P.N. Mantadia ;Analamay ;Foret Ambatovy , 14.3 km 57° Moramanga ;Torotorofotsy ;Andasibe National Park , botanic garden near eIntrance, West of ANGAP office ;Res. Analamazaotra , Parc National , Andasibe ;Fianarantsoa : Foret d'Atsirakambiaty, 7.6 km 285° WNW Itremo ;Ranomafana Nat. Park , Miaranony Forest ;Vohiparara broken bridge , Fianarantsoa Prov . ;Parc National de Ranomafana , Sahamalaotra River , 6.6 km 310° NW Ranomafana ;Parc Nationale Ranomafana : Talatakely ;3 km W Ranomafana , nr. Ifandiana ; research cabin at Talatakely , Ranomafana National Park ; radio tower, Ranomafana National Park , Fianarantsoa Prov .; Namorona River at footbridge, Ranomafana National Park ;Ranomafana National Park , Tavolo tree ;Belle Vue trail , Ranomafana National Park , Fianarantsoa Prov . ;7 km W Ranomafana ;Vatoharanana ;Parc National deRanomafana , Vatoharanana River , 4.1 km 231 ° SW Ranomafana ;P.N. Ranomafana , Vatoharanana-Ankovoka ;8 km E Kianjavato , Vatovavy Forest ;7.6 km 122° Kianjavato , Foret Classee Vatovavy ;2 km W Andrambovato , along river Tatamaly ;Foret d'Ambalagoavy Nord , Ikongo , Ambatombe ;45 km S. Ambalavao ;45 km S Ambalavao ;43 km S Ambalavao , Res. Andringitra ;Parc National d'Isalo , Ambovo Springs , 29.3 km 4° N Ranohira ;8.0 km NE Ivohibe ;9.0 km NE Ivohibe ;R.S. Ivohibe , 7.5 km ENE Ivohibe ;Parc National d'Isalo , 9.1 km 354° N Ranohira ;Foret d'Analalava , 29.6 km 280° W Ranohira ;Foret de Vevembe , 66.6 km 293° Farafangana ;Province Toliara :Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 34.6 km 314° NW Ambaravaranala ;Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 35.2 km 312° NW Ambaravaranala ;Vohibasia Forest , 59 km NE Sakaraha ;southern Isoky-Vohimena Forest , 59 km NE Sakaraha ;Foret Classee d'Analavelona , 33.2 km 344° NNW Mahaboboka ;Foret Classee d'Analavelona , 29.2 km 343° NNW Mahaboboka ;Foret Classee d'Analavelona , 29.4 km 343° NNW Mahaboboka ;Foret de Tsinjoriaky , 6.2 km 84° E Tsifota ;Parc National de Zombitse , 19.8 km 84° E Sakaraha ;Parc National de Zombitse , 17.7 km 98° E Sakaraha ;15 km E Sakaraha ;Foret de Mite , 20.7 km 29° WNW Tongobory ;Sept Lacs; Beza-Mahafaly, 27 km E Betioky ;Ehazoara Canyon , 26 km E Betioky ;70.7 km NNE Tolanaro , Mahermano Mt .; 11 km NW Enakara , Res. Andohahela ;10 km NW Enakara , Res. Andohahela ;Res . Andohahela , 6 km SSW Eminiminy ;Parc National d'Andohahela , Col du Sedro , 3.8 km 113° ESE Mahamavo , 37.6 km 341° NNW Tolagnaro ;Parc National d'Andohahela , Manampanihy River , 5.4 km 113° ESE Mahamavo , 36.7 km 343° NNW Tolagnaro ;2.7 km WNW 302° Ste. Luce ;9.2 km N Tolanaro , Ilapany Mt . ;29.5 km WNW Tolanaro , Vasiha Mt . ;Parc National d'Andohahela , Foret d'Ambohibory , 1.7 km 61° ENE Tsimelahy , 36.1 km 308° NW Tolagnaro ;Mandena , 8.4 km NNE 30° Tolagnaro ;Reserve Prive Berenty , Foret de Bealoka , Mandrare River , 14.6 km 329° NNW Amboasary ;Reserve Prive Berenty , Foret de Malaza , Mandrare River , 8.6 km 314° NW Amboasary ;Reserve Berenty; Foret de Petriky , 12.5 km W 272° Tolagnaro ; 4.4 km 148° SSE Lavanono ;Reserve Speciale de Cap Sainte Marie , 14.9 km 261° W Marovato ;near road, Zombitse National Park , Tulear Prov .; near ANGAP office, ZombitseNational Park , Tulear Prov .;Parcel I, Beza Mahafaly Reserve , near research station, Tulear Province ;Tsimelahy - Parcel II , Andohahela National Park , transition forest, Tulear Province .
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Figures: worker 3a-d, 5c; queen 3e-h; male 3i-j, 8b; map 6b

 

Worker measurements: maximum and minimum based on all specimens, n = 20. HL 0.79-1.19, HW 0.71-1.06, CI 85-95, EL 0.08-0.13, ML 0.33-0.57, MI 41-54, SL 0.57-0.88, SI 78-86, WL 0.87-1.35, FL 0.57-0.90, PW 0.44-0.62.

 

Taxa 18S 28S ITS1 Comments Anochetus goodmani Intra - no variation. nter - 2 bp from A. boltoni , and 3 bp from O. troglodytes , O. coquereli Intra - no variation across north nter -.15 bp divergent from A. madagascarensis . Intra - extreme variation (length and substitution) across range. Some corresponding to deep CO1 splits - provisionally orthologous. However, deep paralogous divergences have been sequenced within single individuals through different amplifications and extractions. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. Anochetus boltoni Intra - no variation. nter - 2 bp from A. goodmani , 2 bp from O. troglodytes and no difference from O. coquereli . N/A Intraspecific variation of 1% (indels and substitutions) between the two sampled populations. Anochetus madagascarensis N/A Intra - no variation. nter -.15 bp divergent from A. goodmani . Intra - variation that does NOT reflect CO1 variation. rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. -Positive Wolbachia test. Anochetus grandidieri N/A N/A Low iIntraspecific variation that does reflect CO1 geographic variation. - Positive Wolbachia test. Anochetus pattersoni N/A N/A N/A Odontomachus coquereli Intra - no variation. nter - 2 bp from O. troglodytes . 2bp from A. boltoni ,and 3 bp from A. goodmani . Intra - variation. Large variation at geographically distal ends of distribution. nter - differentiates between three Malagasy species. Intraspecific variation that only partially reflects geography and CO1 variation - while some clearly does not. Paralogous and orthologous Odontomachus troglodytes Intra - no variation. nter - 2 bp from O. coquereli . 3 bp from A. boltoni ,and3bp from A. goodmani . Intra - some variation that does not correspond to geography or CO1. nter - does not differentiate between O. simillimus Intraspecific variation that only partially reflects geography and CO1 variation All specimens tested positive for Wolbachia. Odontomachus simillimus N/A Intra - no variation. nter - does not differentiate O. troglodytes N/A

 

Queen measurements: maximum and minimum based on n = 5. HL 0.88-1.15, HW 0.81-1.07, CI 92-96, EL 0.17-0.23, ML 0.39-0.56, MI 44-49, SL 0.62-0.87, SI 77-81, WL 1.08- 1.46. FL 0.68-0.96, PW 0.60-0.78.

 

Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.58-0.73, HW 0.78-0.94, CI 129- 135, EL 0.37-0.46, SL 0.10-0.15, SI 13-16, WL 1.17-1.52, FL 0.78-1.08

 

Worker diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05-0.11 mm), projecting dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and sculpture as in Figures 3 a-d.

 

Queens alate: Very similar to workers, only slightly larger than respective size class (Figs 3e-h). Ergatoid queens not recorded.

 

Within a single locality, two size classes of workers, queens and males are present in this species, but the differences within a site do not hold up when variation across all sites is included. These differences suggest that two reproductive and developmental pathways can occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger the development of small and large castes.

 

The species is most similar to A. madagascarensis but can be easily distinguished by its small eyes and scape that does not surpass the occipital lobe. A. madagascarensis has large eyes (0.24-0.26 mm), and scapes that surpass occipital lobes.

 

Distribution and biology. A. grandidieri is endemic to Madagascar and is widespread throughout Madagascar in forest and shrubland habitats below 1,550 m elevation (Fig 4b). It has been collected in gallery, dry, littoral, lowland, and montane forest, in desert spiny bush thicket in the southwest, and Uapaca woodland in the ceIntral plateau. As in many soil dwelling ants, A. grandidieri has reduced eyes (EL/HW 0.11-0.13) and shortscapes . A. grandidieri is the only Anochetus in Madagascar with these soil nesting modifications. The subterranean habitat of this species may allow it to survive in a wide range of habitats in Madagascar from desert to woodland to montane forest. Out of 453 collecting events, A. grandidieri was most often recorded in sifted litter (97 collection records), rotten logs (96), and Malaise traps (155).

 

CO1. Shallow iIntraspecific (average within species sequence divergence of 2.72, SE = 0.048) and deep interspecific divergences(9.4% SE = 0.05) between A. grandidieri and the other species. Small and large castes had identical DNA barcodes. (Figs 9, 16).

 

Diagnostic barcoding loci. A grandidieri : T-273, T-282, T- 306, A-312, (shared with one population of A. goodmani ), A-312, T- 333, A-483, T-528 (all 3rd base pair positions).

 

Specimens examined for Anochetus grandidieri : Specimens from 456 separate collection events from the following 140 localities were examined.MADAGASCAR : Province Antsiranana : Sakalava Beach ;Montagne des Francais , 7.2 km 142° SE Antsiranana ;Antsiranana II Pref: Antsahampano S.-Pref : Montagne d'Ambre. Site MD2 ;Parc National Montagne d'Ambre , 3.6 km 235° SW Joffreville ;Reserve Speciale de l'Ankarana , 13.6 km 192° SSW Anivorano Nord ;Foret d'Ampondrabe , 26.3 km 10° NNE Daraina ;Foret d' Antsahabe , 11.4 km 275° W Daraina ;Foret de Binara , 7.5 km 230° SW Daraina ;Foret de Binara , 9.1 km 233° SW Daraina ;Nosy Be , Lokobe Forest ;Foret Ambato , 26.6 km 33° Ambanja ;Ambondrobe , 41.1 km 175° Vohemar ;Ampasindava, Foret d'Ambilanivy , 3.9 km 181° SAmbaliha ;R.S. Manongarivo , 10.8 km 229° SW Antanambao ;R.S. Manongarivo , 12.8 km 228° SW Antanambao ;R.S. Manongarivo , 14.5 km 220° SW Antanambao ;Foret d'Anabohazo , 21.6 km 247° WSW Maromandia ;Parc National de Marojejy , Manantenina River , 27.6 km 35° NE Andapa , 9.6 km 327° NNW Manantenina ;Parc National de Marojejy, Manantenina River , 28.0 km 38° NE Andapa , 8.2 km 333° NNW Manantenina ;Parc National Marojejy ;Marojejy R.N.I. #12 ;Foret Ambanitaza , 26.1km 347° Antalaha ;9.2 km WSW Befingotra , Res. Anjanaharibe-Sud ;6.5 km SSW Befingotra , Res. Anjanaharibe-Sud ;17 km W Andapa , Res. d' Anjanaharibe-Sud ;5 km SW Antalaha ;14 km W Cap Est , Ambato ;Fotodriana , Cap Masoala .Province Mahajanga : Mahavavy River , 6.2 km 145° SE Mitsinjo ;Reserve d'Ankoririka , 10.6 km 13° NE de Tsaramandroso ;Ampijoroa National Park , 160 km N Maevatanana , Mahajanga Prov ., deciduous forest ;Parc National de Namoroka , 17.8 km 329° WNW Vilanandro ;Parc National de Namoroka , 16.9 km 317° NW Vilanandro ;Parc National de Namoroka , 9.8 km 300° WNW Vilanandro ;Reserve Speciale de Bemarivo , 23.8 km 223° SW Besalampy ;Parc National Tsingy de Bemaraha , 10.6 km ESE 123° Antsalova ;Foret de Tsimembo , 8.7 km 336° NNW Soatana ;Parc National Tsingy de Bemaraha , 2.5 km 62° ENE Bekopaka , Ankidrodroa River ;Parc National Tsingy de Bemaraha , 3.4 km 93° E Bekopaka , Tombeau Vazimba ;Province Toamasina : Montagne d'Anjanaharibe , 19.5 km 27° NNE Ambinanitelo ;Montagne d'Anjanaharibe , 18.0 km 21 ° NNE Ambinanitelo ;Montagne d'Akirindro 7.6 km 341 ° NNW Ambinanitelo ;19 km ESE Maroantsetra ;6.9 km NE Ambanizana , Ambohitsitondroina ;Ambanizana , Parc National Masoala ;5.3 km SSE Ambanizana , Andranobe ;6.3 km S Ambanizana , Andranobe ; 1 km W Andampibe , Cap Masoala ;Parc National Mananara-Nord , 7.1 km 261° Antanambe ;Foret d'Analava Mandrisy , 5.9 km 195° Antanambe ;Res. Ambodiriana , 4.8 km 306° Manompana , along Manompana River ;Ile Sainte Marie , Foret Ambohidena , 22.8 km 44° Ambodifotatra ;Ile Sainte Marie , Foret Kalalao , 9.9 km 34° Ambodifotatra ;Parcelle E3 Tampolo ;S.F. Tampolo, 10 km NNE Fenoarivo Atn . ;Bridge at Onibi , NW of Mahavelona ;Mahavelona ( Foulpointe ) ;2.1 km 315° Mahavelona ;Foulpointe ;Reserve Betampona , Camp Vohitsivalana , 37.1 km 338° Toamasina ;Reserve Betampona , Camp Rendrirendry 34.1 km 332° Toamasina ;F.C. Sandranantitra ;F.C. Didy ;F.C. Andriantantely ;P.N. Mantadia ;Analamay ;Foret Ambatovy , 14.3 km 57° Moramanga ;Torotorofotsy ;Andasibe National Park , botanic garden near eIntrance, West of ANGAP office ;Res. Analamazaotra , Parc National , Andasibe ;Fianarantsoa : Foret d'Atsirakambiaty, 7.6 km 285° WNW Itremo ;Ranomafana Nat. Park , Miaranony Forest ;Vohiparara broken bridge , Fianarantsoa Prov . ;Parc National de Ranomafana , Sahamalaotra River , 6.6 km 310° NW Ranomafana ;Parc Nationale Ranomafana : Talatakely ;3 km W Ranomafana , nr. Ifandiana ; research cabin at Talatakely , Ranomafana National Park ; radio tower, Ranomafana National Park , Fianarantsoa Prov .; Namorona River at footbridge, Ranomafana National Park ;Ranomafana National Park , Tavolo tree ;Belle Vue trail , Ranomafana National Park , Fianarantsoa Prov . ;7 km W Ranomafana ;Vatoharanana ;Parc National deRanomafana , Vatoharanana River , 4.1 km 231 ° SW Ranomafana ;Ranomafana , Vatoharanana-Ankovoka ;8 km E Kianjavato , Vatovavy Forest ;7.6 km 122° Kianjavato , Foret Classee Vatovavy ;2 km W Andrambovato , along river Tatamaly ;Foret d'Ambalagoavy Nord , Ikongo , Ambatombe ;45 km S. Ambalavao ;45 km S Ambalavao ;43 km S Ambalavao , Res. Andringitra ;Parc National d'Isalo , Ambovo Springs , 29.3 km 4° N Ranohira ;8.0 km NE Ivohibe ;9.0 km NE Ivohibe ;R.S. Ivohibe , 7.5 km ENE Ivohibe ;Parc National d'Isalo , 9.1 km 354° N Ranohira ;Foret d'Analalava , 29.6 km 280° W Ranohira ;Foret de Vevembe , 66.6 km 293° Farafangana ;Province Toliara :Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 34.6 km 314° NW Ambaravaranala ;Reserve Speciale d'Ambohijanahary , Foret d'Ankazotsihitafototra , 35.2 km 312° NW Ambaravaranala ;Vohibasia Forest , 59 km NE Sakaraha ;southern Isoky-Vohimena Forest , 59 km NE Sakaraha ;Foret Classee d'Analavelona , 33.2 km 344° NNW Mahaboboka ;Foret Classee d'Analavelona , 29.2 km 343° NNW Mahaboboka ;Foret Classee d'Analavelona , 29.4 km 343° NNW Mahaboboka ;Foret de Tsinjoriaky , 6.2 km 84° E Tsifota ;Parc National de Zombitse , 19.8 km 84° E Sakaraha ;Parc National de Zombitse , 17.7 km 98° E Sakaraha ;15 km E Sakaraha ;Foret de Mite , 20.7 km 29° WNW Tongobory ;Sept Lacs; Beza-Mahafaly, 27 km E Betioky ;Ehazoara Canyon , 26 km E Betioky ;70.7 km NNE Tolanaro , Mahermano Mt .; 11 km NW Enakara , Res. Andohahela ;10 km NW Enakara , Res. Andohahela ;Res . Andohahela , 6 km SSW Eminiminy ;Parc National d'Andohahela , Col du Sedro , 3.8 km 113° ESE Mahamavo , 37.6 km 341° NNW Tolagnaro ;Parc National d'Andohahela , Manampanihy River , 5.4 km 113° ESE Mahamavo , 36.7 km 343° NNW Tolagnaro ;2.7 km WNW 302° Ste. Luce ;9.2 km N Tolanaro , Ilapany Mt . ;29.5 km WNW Tolanaro , Vasiha Mt . ;Parc National d'Andohahela , Foret d'Ambohibory , 1.7 km 61° ENE Tsimelahy , 36.1 km 308° NW Tolagnaro ;Mandena , 8.4 km NNE 30° Tolagnaro ;Reserve Prive Berenty , Foret de Bealoka , Mandrare River , 14.6 km 329° NNW Amboasary ;Reserve Prive Berenty , Foret de Malaza , Mandrare River , 8.6 km 314° NW Amboasary ;Reserve Berenty; Foret de Petriky , 12.5 km W 272° Tolagnaro ; 4.4 km 148° SSE Lavanono ;Reserve Speciale de Cap Sainte Marie , 14.9 km 261° W Marovato ;near road, Zombitse National Park , Tulear Prov .; near ANGAP office, ZombitseNational Park , Tulear Prov .;Parcel I, Beza Mahafaly Reserve , near research station, Tulear Province ;Tsimelahy - Parcel II , Andohahela National Park , transition forest, Tulear Province .

License not applicable

Fisher, B. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ queen ]], long. 3,5 mm. Jaune-roussatre, pattes un peu plus claires. Bout des dents des mandibules et metanotum brunatres. Une forte ponctuation pilifere espacee d'un a deux diametres de point sur la moitie posterieure de la tete et l'epinotum. Un pinceau de fines stries va des aretes frontales a mi-distance de l'ocelle median. L'epinotum et le col sont en outre un peu rides en travers. Quelques points clairsemes sur le reste du thorax; partout ailleurs lisse et luisante. Une pubescence courte et assez abondante sur les appendices et le gastre, plus relevee sur la tete, plus rare sur le thorax. Seulement quelques poils obliques sur le thorax.

 

Tete faiblement echancree derriere (vue de front), bien moins que chez africanus v. madagascariensis For. Les cotes presque droits du devant des yeux aux angles posterieurs, se retrecissant au devant des yeux lesquels ne font pas saillie lateralement. Leur diametre egale la largeur des mandibules au tiers externe. Un fort sillon frontal jusqu'a l'ocelle. Epistome a prolongement lanceole entre les aretes frontales, comme chez africanus (absent chez grandidieri For.), le bord anterieur convexe. Mandibules a bord anterieur subdenticule ou ponctue, passant sans angle aux trois longues dents terminales, la mediane un peu plus courte et soudee en partie a l'inferieure. Le scape atteint juste le bord posterieur de la tete. Articles 2 et 3 du funicule aussi larges que longs, les suivants de plus en plus longs. Pronotum plus epaule que chez africanus mais les angles sont tres arrondis. Face basale de l'epinotum presque aussi large que longue jusqu'aux dents. Celles-ci sont relevees mais tres mousses au bout. Face declive a peine concave sur le profil et: aussi longue que la basale. Ecaille aussi haute que l'epinotum, echancree au sommet, les cotes assez arques, * presque trois fois plus haute que longue a la base. Etranglement postpetiolaire assez accentue. Madagascar: Nossi-Be (DESCARPENTRIES) [[ queen ]].

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anochetus grandidieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 139
Specimens with Barcodes: 168
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Anochetus grandidieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 147 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTAGCTATTTGATCTGGAATAATTGGTTCTTCTATAAGAATATTAATTCGTTTAGAATTAGGAACATGTAATTCATTAATTATAAATGATCAAATTTATAATTCTTTAATTACTAGACATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAATTATTTAGTTCCTTTAATATTAGGATCTCCAGATATAGCATATCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAATTTTATTATTATCAAGAAGATTAGTTTATAAAGGAGTAGGAACAGGATGAACTGTTTATCCTCCTTTATCAAATAATTTATATCATAATGGATTTTCAGTTGATTTAGCTATTTTTTCTTTACATATTGCAGGAATATCATCAATTATAGGAGCAATTAATTTTATTTCAACAATTTTAAATATACATCATAAAAATTTATCATTAGATAAAATTCCTTTATTAGTTTGATCAATTTTAATTACAGCTATTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAACTTTTTTTGATCCTTCAGGTGGTGGAGATCCAATTTTATATCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!