Overview

Brief Summary

Introduction

Gonatus madokai was described by Kubodera and Okutani (1977) based on a large holotype (329 mm ML) and two juvenile paratypes (72 mm DML) with three additional specimens (40-63 mm ML) collected from the subarctic waters of the northwestern North Pacific.

Morphological changes with growth of this species were well described (Kubodera and Okutani 1977). G. madokai is one of a few gonatids that can be identified almost throughout its life.

Diagnosis

A Gonatus with ...

  • pronouncedly long arms (ca. 90% of ML), long tail (ca. 20% of ML) and soft body.
  • large fins (FL>1/2ML), sagittate with round sides (FW=83% of FL).
  • tentacle club with a central large hook, a middle-sized hook distal to the central hook and five small hooks in a line proximal to the central hook.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Arms long and thick, but not so muscular.
    2. Arm III longest (90%ML), arm I shortest (4/5 of arm III).
    3. Arms III and IV with thin membranous aboral keels along entire lengths.
    4. Number of hooks and suckers on arm III 46-47 and 52, respectively.

      Figure. Ventral view of G. madokai (Holotype), 329 mm ML.

  2. Tentacles
    1. Club with 5 small hooks in series proximal to large central hook.
    2. Club with medium-sized hook distal to large central hook.
    3. Club suckers of dorsal- and ventral marginal zones merge proximally.

    4. Figure. Oral views of the tentacle and club of G. madokai, 329 mm ML, hologype. Top - Tentacle. Bottom - Enlargement of the tentacular club. Bar 10 mm. Drawings from Kubodera & Okutani (1977)

  3. Head
    1. Head almost squarish in shape, slightly narrower than the mantle opening.
    2. Funnel cartilage lanceolate in shape, nuchal cartilage rectangular with three grooves.
    3. Dorsal funnel organ inverted V-shaped, ventral ones oval in shape.
    4. Beaks. Information on the beaks of G. madokai can be found here.
    5. Radula composed of 5 rows of teeth.

  4. Fins and tail
    1. Fins large sagittate, fin length > 1/2 ML, fin width about 4/5 FL.
    2. Tail long gelatinous, about 22% of ML.

  5. Photophores
    1. Photophores absent.

Figure. Juvenile G. madokai (Paratype#1: 72mm ML). A - Ventral view. B - Oral view of right tentacular club. C - Oral view of dactylus sucker. D - Oral view of medial sucker proximal to the central hook. E - Side view of arm III hook. F - Oral view of arm III sucker. G - Oral view of arm IV sucker, medial series. H - Oral view of arm IV sucker, marginal series. Drawings from Kubodera and Okutani (1977).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North West Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

G. madokai is widely distributed in the subarctic Pacific, and it is especially abundant in the deeper layers of the Okhotsk Sea (Nesis 1997).


Figure. Distribution of G. madokai based mainly on larval net sampling at surface layer. Drak pink area indicates known range; light pink area indicates inferred range. Chart modified from Okutani et al. (1988).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

epipelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 5 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Morphological changes with growth of G. madokai were reported by Kubodera and Okutani (1977). Paralarvae and juveniles of G. madokai ranging 8-72mm ML may be identified by having a swollen bell-shaped mantle, trapezoidal head, which is constricted at the base of the arms making eyes protuded in smaller specimens, and slender long arms and tentacles.


Figure. Morphological changes with growth of Gonatus madokai. A: ventral view of a 11mm ML, B: tentacle of A, C: ventral view of a 22mm ML, D: tentacle of C, E: ventral view of 40mm ML, F: tentacle of E. Drawings from Kubodera and Okutani (1977)

Paralarvae can be identified by the dorsal-head chromatophore pattern which is Type I (three tear-shaped chromatophores on each side.); the mantle has 18 dorsal and 28 ventral chromatophores (Jorgensen, 2006).


Figure. Dorsal views of the chromatophores of a G. madokai paralarva, 10.9 mm ML, Gulf of Alaska. Left - Head. Right - Paralarva. Drawing from Jorgensen (2007).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus madokai

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATCTTTGGTATTTGAGCAGGCCTACTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGACAACCTGGATCTCTACTAAACGAC---GATCAACTATATAACGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTGGTTCCCTTAATATTAGGTGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGATTTTGATTATTACCTCCTTCCTTAACACTATTACTAGCTTCCTCAGCTGTTGAAAGAGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGTAACTTATCTCATGCTGGCCCTTCAGTCGACTTAGCAATTTTTTCTCTACATTTAGCAGGTGTATCCTCTATTTTAGGAGCTATTAATTTCATTACTACAATTTTAAATATACGATGAGAAGGCTTACAAATAGAACGATTGCCTCTATTTGCTTGATCTGTATTTATTACCGCAATTTTATTATTATTATCGCTTCCTGTTCTAGCCGGAGCTATTACTATGTTATTAACTGACCGAAATTTTAATACGACCTTTTTTGACCCGAGAGGAGGAGGGGACCCTATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus madokai

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!