Overview

Brief Summary

Introduction

Eogonatus tinro was first described but not named by Fields and Gauley (1971) then described and named by Nesis (1972). The paralarval, early juvenile and mature adult stages are not known. E. tinro is uncommon and although generally thought to be a small species, may reach a rather large size (Katugin, personal communication).


Figure. Ventral and side views of E. tinro, ca. 90 mm ML. Note the very large eyes, small tentacles and long tail. © Tsunemi Kubodera

Brief diagnosis:

A gonatid ...

  • without hooks on tentacular club.
  • with 2-3 small ridges and grooves, and associated suckers and knobs, in proximal (carpal) locking-apparatus of tentacular club.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Hooks in medial two armature series on arms I-III.

  2. Tentacles
    1. Tentacles present in subadults.
    2. Tentacular club without hooks.
    3. Suckers of tentacular club in numerous irregular series; suckers about equal in size.
    4. Proximal locking-apparatus of club with suckers and knobs medial to 2-3 small ridges and grooves.
    5. Figure. Oral view of the tentacle of E. tinro. Drawing from Nesis (1972).


      Figure. Oral view of the tentacular club of E. tinro, 65 mm ML, 45°07'N, 162°53'E. Drawing from Fields and Gauley (1971).

  3. Head
    1. Beaks. Descriptions can be found here: Lower beak; upper beak. See also this site.
    2. Radula with teeth in 5 series.

  4. Mantle
    1. Mantle tissue flabby.

  5. Fins
    1. Fins sagittate, drawn out posteriorly into a short tail.

  6. Photophores
    1. Photophores absent.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Type locality: 58°22.2'N, 174°55'W, Bering Sea, North Pacific.

Figure. Distribution of E. tinro Dark pink area indicates known range; light pink area indicates inferred range. Chart modified from Okutani, et al. (1988).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus tinro

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTACTAGGAACTTCCCTAAGCCTGATAATTCGAACTGAATTGGGGCAACCTGGCTCTCTACTAAACGAC---GATCAACTTTATAACGTTGTAGTCACAGCCCATGGATTTATTATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTCCCCTTAATATTAGGGGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCCTTAACACTATTGTTAGCCTCTTCAGCTGTTGAAAGAGGGGCGGGTACAGGATGAACAGTCTACCCTCCTCTTTCTAGTAACCTATCTCATGCAGGTCCTTCAGTTGACTTAGCCATTTTTTCTTTACATTTAGCTGGAGTATCTTCTATTCTAGGAGCCATTAATTTCATTACTACAATTTTAAATATGCGATGGGAAGGGTTACAAATAGAACGCTTACCTCTTTTTGCTTGATCTGTTTTTATTACTGCAATTTTACTACTCTTATCCCTCCCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGACCGAAACTTTAATACAACCTTTTTTGACCCAAGAGGAGGGGGTGATCCTATTCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus tinro

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!