Overview

Distribution

Range Description

This species is found in the boreal and sub-Arctic regions of the North Pacific Ocean. Its type locality is in the Kuril Islands and it occurs in the Sea of Okhotsk, the Bering Sea and southwards to California (Roper and Jereb 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
These are large pelagic and oceanic squids that reach up to 66 cm in mantle length (Young and Mangold 2009). They appear to undergo downward ontogenetic vertical migration, with paralarvae occurring in the upper 200 m, juveniles between 400 and 600 m, and adults migrating to depths deeper than 2,000 m to mature (Voss et al. 1992). Unvalidated statolith growth increment analysis suggests this species grows rapidly in the upper mesopelagic, attaining 37-45 cm in mantle length within the first 8-10 months before migrating to bathyal depths (Arkhipkin 1996). Overall, little is known about its biology and ecology.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taonius borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCAGGATTATTAGGTACTTCATTAAGATTAATAATCCGTACTGAATTAGGACAACCAGGATCACTACTAAATGAT---GATCAATTATACAATGTAGTAGTGACCGCTCATGGATTTATTATAATTTTTTTCTTAGTAATACCAATTATGATTGGAGGATTTGGAAATTGACTAGTTCCATTGATACTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTTCTCCCTCCTTCCCTCACACTTTTACTAGCCTCTTCTGCTGTTGAAAGAGGAGCAGGAACAGGATGAACAGTCTATCCTCCTTTATCTAGAAATTTATCTCACGCTGGACCCTCTGTAGATGTAGCTATTTTTTCTCTCCATTTAGCAGGAGTATCATGTATTCTTGGAGCAATTAATTTTATTACAACTATCTTAAACATACGTTGAGAAGGTCTCCAAATAGAACGATTACCTCTTTTTGCTTGATCCGTTTTTATTACTGCAATTCTATTACTTTTATCCTTACCAGTATTAGCAGGAGCCATTACTATATTATTAACCGATCGAGATTTTAACACTACCTTTTTTGACCCTAGAGGAGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taonius borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Young, R., Vecchione, M. & Böhm, M.

Contributor/s

Justification
Taonius borealis is an oceanic species which has a wide geographic distribution and inhabits deep-water, making it is less susceptible to human impact. It has therefore been assessed as Least Concern. However, more research is still needed on its ecology and biology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Further research is recommended, specifically on the distribution, population abundance and ecology of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!