Overview

Brief Summary

Introduction

This species is known only from Antarctic waters. It reaches size of 27 cm ML (Nesis, 1982).

Brief diagnosis:

A neoteuthid ...

  • with greatly enlarged suckers in medial two sucker-series of distal-manus.
  • with enlarged tooth on inner ring of proximal arm suckers, becoming a blunt hook in large individuals.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Alluroteuthis antarcticus Odhner, 1923

 

 

OTHER SCIENTIFIC NAMES STILL IN USE:

 

Parateuthis tunicata Thiele, 1921

 

? Crystalloteuthis glacialis Clarke, 1980

 

 

VERNACULAR NAMES:

 

 

FAO/CCAMLR:

 

En - Antarctic neosquid

 

Fr - Louténe australe

 

Ru - Antarkticheskyi myagkotelyi kalmar

 

Sp - Neoluria antártica

 

 

NATIONAL:

 

 

DISTINCTIVE CHARACTER:

 

 

Mantle conical. Fins oval, anterior lobes absent, posterior lobes free. Head and eyes large; buccal connectives attach to dorsal bor­ders of arms IV. Funnel-locking cartilage straight, simple. No photophores. Tentacles relatively thin; clubs with 6 to 8 enlarged suckers on median rows of manus, many rows of very small, extremely numerous suckers on carpus, with a few pairs of suckers/knobs extending proximally along the stalk; arms robust; suckers on arms biserial, those on arm IV reduced in size.

 

 

Lower beak: has hood with a broad notch and lies close to crest; thickened wing fold with ridge has characteristic shape in profile and obscures jaw angle from side; jaw angle acute or recessed; crest broad and thic­kened; no fold or ridge on lateral wall.

 

 

DISTINGUISHING CHARACTERS OF SIMILAR SPECIES OCCURRING IN THE AREA:

 

 

Several families (Histioteuthidae, Bathyteuthidae and Psychroteithidae) have similar general characters, but can be differentiated as follows:

 

Histioteuthis species (Histioteuthidae): photophores present on mantle.

 

 

Bathyteuthis abyssicola (Bathyteuthidae): photophores present at bases of arms.

 

 

Psychroteuthis glacialis (Psychroteuthidae): posterior fin attachment concave.

 

 

SIZE:

 

 

Maximum reported mantle length 11 cm.

 

 

GEOGRAPHICAL DISTIRBUTION AND BEHAVIOR:

 

 

All sectors of the Antarctic Ocean; circumpolar.

 

 

An oceanic species, occurring in depths between 750 and 2800 m. A prey of sperm whales, elephant and Weddell seals. The annual consumption of this species by sperm whales in the Antarctic is estimated to be about 0.01 × 106 t.

 

 

INTEREST TO FISHERIES:

 

 

Currently none.”

 

 

 

(Roper et al, 1985: 169-170)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Arms
    1. In large individuals, suckers in middle of arms I-III with blunt hooks.

  2. Tentacles
    1. Distal manus with suckers greatly enlarged in medial two series.
    2. Large distal-manal suckers with ca. 60 pointed teeth on inner rings.
    3. Length of proximal manus about equal to length of distal manus.
    4. Club proximal locking-apparatus along dorsal margin of proximal manus and oral midline of tentacle stalk.

    Figure. Oral view of tentacular club of A. antarcticus. Drawing from Roper, et al., 1969.

    Figure. Oral view of tentacular club of A. antarcticus, preserved. Photograph by R. Young.

  3. Fins
    1. Length 35-40% of ML.

Comments

More details of the description can be found here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The type locality is: 63°-64°S, 45°-51°W in Antarctic waters, 0-2800 m depth.

A distribution map of this species is maintained by the British Antarctic Survey.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

meso-bathypelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 0 - 2825.5
  Temperature range (°C): -1.636 - 1.878
  Nitrate (umol/L): 24.188 - 32.323
  Salinity (PPS): 33.694 - 34.729
  Oxygen (ml/l): 4.562 - 8.036
  Phosphate (umol/l): 1.558 - 2.321
  Silicate (umol/l): 18.849 - 122.087

Graphical representation

Depth range (m): 0 - 2825.5

Temperature range (°C): -1.636 - 1.878

Nitrate (umol/L): 24.188 - 32.323

Salinity (PPS): 33.694 - 34.729

Oxygen (ml/l): 4.562 - 8.036

Phosphate (umol/l): 1.558 - 2.321

Silicate (umol/l): 18.849 - 122.087
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Unlike larger squids, in juvenile A. antarcticus, the tentacles are very small compared to the arms.

Figure. Left - Oral view of brachial crown of A. antarcticus, type specimen, 14.5 mm ML. Drawing from Odhner (1923). Right - Side view of A. antarcticus, 18 mm ML, NMNH #727521, Antarctic ocean, preserved. The tentacles are indicated by white arrows in the illustration at right. Photograph by R. Young.

The structure of the tentacle of the juvenile (right), however, looks similiar to that of the subadult.

Figure. Oral view of tentacle of a juvenile of A. antarcticus, type specimen, 14.5 mm ML. Drawing from Odhner (1923).

Odhner (1923) suggested that Parateuthis tunicata Thiele, 1920, described from a paralarva taken in Antarctic waters, might be the young of his Alluroteuthis antarcticus based on similarities of the radula. Roper, et al. (1969) indicated that new specimens in their possession suggested that Odhner was correct. However, their study was never completed and the synonomy of the two species remains uncertain. If the synonomy is proven correct, Parateuthis tunicata, the older species, will be the proper name.

Figure. Dorsal, ventral and lateral views of Parateuthis tunicata, 8 mm ML. Drawings from Thiele (1920).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alluroteuthis antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGCATTTGAGCAGGATTACTTGGGACTTCCCTAAGACTAATAATCCGAACTGAACTAGGACAACCAGGGTCATTACTAAATGAC---GACCAACTATATAATGTAGTGGTCACAGCCCATGGATTTATTATAATTTTCTTTTTAGTTATACCTATTATAATTGGAGGTTTTGGTAACTGACTAGTACCTTTAATACTAGGCGCCCCAGATATAGCTTTCCCACGAATAAATAACATAAGTTTCTGATTACTGCCCCCATCTCTAACACTTCTGCTAGCTTCTTCAGCCGTTGAAAGAGGAGCTGGGACAGGATGAACAGTTTACCCCCCTCTATCTAGAAATTTATCACACGCTGGTCCCTCGGTAGACTTAGCTATTTTTTCTCTACACTTAGCAGGTGTATCTTCCATTCTAGGAGCAATTAATTTCATCACAACAATTTTAAATATACGGTGGGAAGGGTTACAAATAGAACGATTACCTTTATTTGCCTGATCTGTATTTATTACTGCAATTTTACTACTTCTATCTCTTCCTGTCCTTGCTGGGGCAATTACGATACTTTTAACAGACCGAAATTTCAACACCACCTTTTTTGACCCAAGGGGTGGAGGAGACCCAATTTTATACCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alluroteuthis antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alluroteuthis antarcticus

Alluroteuthis antarcticus, the Antarctic neosquid, is the only neosquid in the genus Alluroteuthis.[1] The tentacles are relatively short compared to the arms. Nils Hjalmar Odhner, discoverer of the species, suggested that Parateuthis tunicata, discovered by Johannes Thiele in 1920, might be a young Antarctic neosquid. The validity of this suggestion is still in question. The name is derived from its habitat in the Antarctic Ocean.

References[edit]

  1. ^ a b ""Alluroteuthis antarcticus"". Tree of Life Web Project. Retrieved 9 November 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!