Overview

Comprehensive Description

Description

 Cirratulus cirratus has a long, slender, orange, pinkish or brownish-red body, with 75 to 130 segments, and can reach 12 cm in length. The head is a blunt cone with a row of 4 to 8 large black eyes either side that may meet on top of the head. There are two groups of up to 8 feeding tentacles on the first segment. Pairs of long slender gills arise at intervals from the whole length of the body and these appear as a mass of reddish threads when the worm is buried.Cirratulus cirratus is usually found in aggregations of up to 200 individuals. During the breeding season their colour changes, the females become bright yellow and the males white.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Atlantic, Baie de la Seine, Belgian Exclusive Economic Zone, Canada, Canadian part of the Arctic Ocean, Cobscook Bay, European waters (ERMS scope), Golfe Normanno-Breton, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, Japan, Mozambique, North East Atlantic, North West Atlantic, Pacific Ocean, Philippines, Plymouth, Portuguese Exclusive Economic Zone, Roscoff, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, West Coast of Norway , Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

northern Gaspe waters, downstream part of middle St. Lawrence estuary, lower St. Lawrence estuary, Lower North Shore; Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Cobscook Bay to Cape Cod
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores and seagrass beds.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

intertidal and infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 310 specimens in 1 taxon.
Water temperature and chemistry ranges based on 206 samples.

Environmental ranges
  Depth range (m): 0 - 1350
  Temperature range (°C): -1.369 - 18.117
  Nitrate (umol/L): 0.267 - 36.002
  Salinity (PPS): 27.165 - 38.605
  Oxygen (ml/l): 4.840 - 7.913
  Phosphate (umol/l): 0.088 - 2.338
  Silicate (umol/l): 1.450 - 103.415

Graphical representation

Depth range (m): 0 - 1350

Temperature range (°C): -1.369 - 18.117

Nitrate (umol/L): 0.267 - 36.002

Salinity (PPS): 27.165 - 38.605

Oxygen (ml/l): 4.840 - 7.913

Phosphate (umol/l): 0.088 - 2.338

Silicate (umol/l): 1.450 - 103.415
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Occurs on the lower shore in mud or muddy sand beneath or between rocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirratulus cirratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCACACTGTATTTTCTTTTAGGAATCTGAGCAGGAATAGCCGGCACTACTTTAAGGCTGGTTATTCGTATTGAGCTTGCTCAACCAGGCTCGGTCCTAGGAAACGAACAACTTTACAATGTTATTGTCACAGCCCACGCGTTCTTGATAATTTTCTTCCTCGTTATACCCGTCTTCGTTGGAGGATTTGGTAACTGACTCATCCCCCTGATAATCGGCTCTCCAGACATGTCTTTCCCACGACTAAATAATCTAAGATTCTGACTTCTACCCCCCTCATTAATTCTTCTTGTAGTATCAACAATAGTTGATCAAGGCGTCGGTACCGGCTGAACTGTTTACCCCCCTCTCGCTAGTGTAAAATACCATGGCGGCCCTGCAGTAGATATGGCCATTTTTTCCTTACACCTCGCTGGTGCCAGCTCAATCCTTGGCTCAATCAACTTTCTAGTAACCGCCCGAACAACACGTAAGCAAGGTATAACAGGAGAACGCATACCACTATTTGTTTGATCCCTTGTTGTAACTACTGTTCTACTCCTGGTCTCCCTACCCGTTTTAGCCGGGGCCATCACAATACTACTCACCGACCGCAACTTTAATACCACCTTCTTCGCCCCCGCAGGTGGGGGAGATCCCGTTCTTTATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cirratulus cirratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cirratulus cirratus

Cirratulus cirratus is a species of marine polycheate worm in the family Cirratulidae. It occurs in the littoral and sub-littoral zones of the Atlantic Ocean.

Polychaetes, or marine bristle worms, have elongated bodies divided into many segments. Each segment may bear setae (bristles) and parapodia (paddle-like appendages). Some species live freely, either swimming, crawling or burrowing, and these are known as "errant". Others live permanently in tubes, either calcareous or parchment-like, and these are known as "sedentary".

Contents

Description

C. cirratus grows to up to thirty centimetres long with up to 150 segments. It has a slender, orange, pinkish or brownish body. The prostomium or head is a blunt cone with a row of 4 to 8 large black eyes on either side. The first segment bears two groups of up to eight feeding tentacles. At intervals along the body there are pairs of long slender gills which look like a mass of reddish threads.[2] Short, blunt bristles are found on segments 10 to 12 and more on segments 20 to 23.[3]

Distribution and habitat

C. cirratus is found along the coasts of north west Europe and also in the south Atlantic Ocean. It mostly occurs living in burrows on the lower shore in mud or muddy sand, often underneath or between rocks.[2]

Biology

C. cirratus is a filter feeder, catching particles floating past with its tentacles and conveying them to its mouth.[2]

The sexes are separate and the worms become sexually active spasmodically at intervals of one to two years. The males are white at this time and the females yellowish due to the oocytes in their coelom.[4] Once the oocytes have been fertilised, they are stuck to rocks in a jelly-like mass. They hatch after six days into ciliated post-trochophore larvae. These live off the yolk sac for about twenty-four days before settling and starting filter feeding.[5] Asexual reproduction by means of clones growing from the posterior of the worm have been recorded, but the taxonomic status of Cirratulus is under constant review and this report may refer to a different species.[6]

References

  1. ^ World Register of Marine Species
  2. ^ a b c Marine Life Information Network
  3. ^ Marine Species Identification Portal
  4. ^ Gibbs, P.E., (1971). Reproductive cycles in four polychaete species belonging to the family Cirratulidae. Journal of the Marine Biological Association of the United Kingdom, 51, 745-769.
  5. ^ Reproduction of a Northumberland population of the polychaete Cirratulus cirratus
  6. ^ Petersen, M.E., (1999). Reproduction and development in Cirratulidae (Annelida: Polychaeta). Marine Biology, 8, 243-259.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!