Overview

Brief Summary

Introduction

We present here a description of H. hawaiiensis, but we know of no features that separate it from H. dispar. The two species, which are found in separate oceans, have not been compared side by side, and, therefore, have not been synonymized. Hopefully, DNA data will tell us before long if careful morphological comparisons are needed. H. dispar has priority but our access to specimens in excellent condition and illustrations of H. hawaiiensis is responsible for presenting a more complete description of this species.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Web between arms IV absent.
    2. Male
      1. Each arm III with two or three greatly enlarged suckers.
      2. Enlarged arm III suckers with at least one in dorsal series and one in ventral series.
      3. Right arms I and II hectocotylized; arm II with numerous glandular structures; large gland between arms I and II mostly proximal to sucker bearing regions.
      4. Tips of arms IV with 3-4 irregular series of suckers. This feature was missed by the artist in the drawing below.
      5. Figure. Oral view of the brachial crown of H. hawaiiensis. Drawing by A. Hart.



        Figure. Oral view of various arms of H. hawaiiensis, male. Top - Brachial crown. Bottom left - Hectocotylized right arms I and II showing glandular regions on arms II, same animal as above. Tissue stained with methylene blue stain. . Bottom right - Tip of arm IV, male, 21 mm ML, showing multiple sucker series. Photographs by R. Young.

    3. Female
      1. Arms I and II with bare tips.
      2. Tips of arms IV with 3-4 irregular series of suckers.
      3. Figure. Oral view of various arms of H. hawaiiensis, female. Top - Arms I-III. Drawing by A. Hart. Bottom - Brachial crown with arms I in the center. Photograph by R. Young.

      4. Arm bases in females with papillate tissue.

      5. Figure. Anteroventral view of the oral surfaces of the arm bases of H. hawaiiensis showing papillate surfaces that extend onto the base of the buccal crown. Arms stained with methylene blue stain. Photograph by R. Young.

  2. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.

Comments

More details of the description of H. hawaiiensis can be found here.

Comparisons of the H. hawaiiensis with other species of Heteroteuthis can be found on the Heteroteuthis Page.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The geographic distribution of this species ranges from Hawaii to southern Japan (Ogasawara and Ryukyu Islands), Indonesia and the Great Australian Sea Bight (off Southern and Western Australia) (Reid and Jereb 2005). Its full extent is unknown but it probably encompasses the majority of the Central and Western Pacific. Records of H. dispar from the eastern Pacific and Indian Ocean may pertain to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Stephanoteuthis hawaiiensis Berry, 1909
Catalog Number: USNM 214311
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Isopropyl Alcohol
Year Collected: 1902
Locality: Kauai Island, Hanamaulu Warehouse, S 33 Deg., W 9.5 Min., Hawaii, United States, North Pacific Ocean
Depth (m): 704 to 914
Vessel: Albatross R/V
  • Holotype: Berry, S. 1909. Proc. U.S.N.M. 37: 409-410, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species attains a mantle length of up to 30 mm (Reid and Jereb 2005). It inhabits the open ocean to depths of 820 m (Reid and Jereb 2005), and undergoes diel vertical migration rising up to 150 to 200 m at night to feed (Norman 2003). This species has a light organ which emits just enough light to hide its silhouette from predators in the half light of dusk and dawn (Norman 2003). It also uses clouds of ink and the light organ bacteria to distract predators (Norman 2003). In mature males the first pair of arms are joined and the third arms have enlarged suckers (Norman 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 65 - 2780
  Temperature range (°C): 1.625 - 21.549
  Nitrate (umol/L): 0.892 - 37.598
  Salinity (PPS): 34.271 - 38.973
  Oxygen (ml/l): 2.188 - 5.626
  Phosphate (umol/l): 0.102 - 2.486
  Silicate (umol/l): 1.173 - 105.408

Graphical representation

Depth range (m): 65 - 2780

Temperature range (°C): 1.625 - 21.549

Nitrate (umol/L): 0.892 - 37.598

Salinity (PPS): 34.271 - 38.973

Oxygen (ml/l): 2.188 - 5.626

Phosphate (umol/l): 0.102 - 2.486

Silicate (umol/l): 1.173 - 105.408
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 110 - 1350
  Temperature range (°C): 4.461 - 6.962
  Nitrate (umol/L): 31.076 - 39.003
  Salinity (PPS): 34.099 - 34.483
  Oxygen (ml/l): 1.730 - 3.217
  Phosphate (umol/l): 2.269 - 2.757
  Silicate (umol/l): 49.738 - 98.361

Graphical representation

Depth range (m): 110 - 1350

Temperature range (°C): 4.461 - 6.962

Nitrate (umol/L): 31.076 - 39.003

Salinity (PPS): 34.099 - 34.483

Oxygen (ml/l): 1.730 - 3.217

Phosphate (umol/l): 2.269 - 2.757

Silicate (umol/l): 49.738 - 98.361
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heteroteuthis hawaiiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTTATTTTCGGTATCTGATCAGGTCTACTAGGAACATCATTAAGGTTGATAATTCGAACTGAATTAGGAAAACCTGGATCACTGTTAAATGAT---GATCAGTTATATAATGTAGTAGTTACTGCTCACGGATTCGTTATAATTTTTTTTTTAGTTATACCTATTATAATTGGGGGGTTTGGTAATTGATTAGTGCCTTTAATATTAGGGGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTCTGATTATTACCACCTTCCTTAACTTTACTGCTAGCTTCCTCAACCGTAGAAAGTGGGGCCGGAACAGGCTGAACGGTTTATCCTCCTTTATCTAGTAATATTTCCCATGCAGGACCTTCTGTTGATTTAGCCATTTTTTCTCTACATTTAGCGGGAGTATCCTCAATTCTAGGGGCTATTAACTTTATCACAACTATTTTAAATATACGATGAGAAGGTCTACAAATAGAACGCTTACCTTTATTTGTGTGATCTGTTTTTATTACTGCTATTTTATTACTTTTATCCTTGCCTGTGTTAGCTGGAGCAATTACAATATTATTAACTGACCGAAATTTTAATACTACCTTTTTTGACCCCAGAGGGGGGGGGGACCCTATTTTATACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heteroteuthis hawaiiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Allcock, L. & Barratt, I.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Heteroteuthis hawaiiensis has been assessed as Data Deficient as major taxonomic issues exist which need clarifying.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

The population size of this species is unknown.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further research is required to resolve taxonomic uncertainties and determine population trends and life history patterns of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Heteroteuthis hawaiiensis

Heteroteuthis hawaiiensis is a species of bobtail squid native to the central and western Pacific Ocean. It occurs in waters off Hawaii, Bonin, the Ryukyu Islands, Indonesia, and the Great Australian Bight. H. hawaiiensis may also be present in Banc Combe in the southwestern Pacific (12°14′S 177°28′W / 12.233°S 177.467°W / -12.233; -177.467) at depths of 795 to 820 m.[1]

H. hawaiiensis grows to approximately 30 mm in mantle length.[1]

The type specimen was collected near Kauai in the Hawaiian Islands. It is deposited at the National Museum of Natural History in Washington, D.C..[2]

References[edit]

  1. ^ a b Reid, A. & P. Jereb 2005. Family Sepiolidae. In: P. Jereb & C.F.E. Roper, eds. Cephalopods of the world. An annotated and illustrated catalogue of species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes. No. 4, Vol. 1. Rome, FAO. pp. 153–203.
  2. ^ Current Classification of Recent Cephalopoda
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Heteroteuthis serventyi

Heteroteuthis serventyi is a species of bobtail squid native to the southwestern Pacific Ocean, off southeastern Australia.[1]

The type specimen was collected in Jervis Bay, New South Wales and is deposited at the Australian Museum in Sydney.[2]

References

  1. ^ Reid, A. & P. Jereb 2005. Family Sepiolidae. In: P. Jereb & C.F.E. Roper, eds. Cephalopods of the world. An annotated and illustrated catalogue of species known to date. Volume 1. Chambered nautiluses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes. No. 4, Vol. 1. Rome, FAO. pp. 153–203.
  2. ^ Current Classification of Recent Cephalopoda
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!