Articles on this page are available in 1 other language: Arabic (21) (learn more)

Overview

Comprehensive Description

Additional information

Polychaeta larva, whose adults are not listed before, found in plankton samples
  • Harms, J. (1993). Check list of species (algae, invertebrates and vertebrates) found in the vicinity of the island of Helgoland (North Sea, German Bight): a review of recent records. Helgol. Meeresunters. 47: 1-34
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The body of the parchment tube worm, Chaetopterus variopedatus, is divided into three sections (Voss 1976). The anterior end is a combination of bristle-bearing segments and a shovel-like mouth. Paddle-like structures are found on the middle segment, which are used for pumping water through the subsurface tube. Finally, the body tapers through a series of segments toward the posterior section. The color of C. variopedatus is cream to pale pinkish, and the animal is capable of emitting intense bioluminescent flashes in response to external stimuli (see 'Community Ecology' below for more information). The worm usually remains burrowed beneath the sediment in its U-shaped tube, composed of a parchment-like material imbedded with sand grains (Voss 1976). Both ends of the tube project about 10-13 cm above the sediment surface, like tapering chimneys. Tubes can be seen washed ashore on nearby beaches after strong storms.
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Chaetopterus variopedatus is a stout worm, up to 25 cm long, that is a filter feeder. It is yellowish or greenish white in colour with mature females becoming pinkish. The body is divided into 3 distinct regions, the short anterior end with an inconspicuous head, a mid region with highly specialized feeding structures, and a longer, regularly segmented hind end with repeating appendages. The worms live permanently in tough, flexible tubes of a whitish parchment-like material. The open end is narrow and protrudes slightly from the substratum.Occasionally other species of polychaete may occupy vacant tubes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Status of this species needs re-examination. Species probably not present in the Channel.
  • Dauvin, J.-C.; Dewarumez, J.-M.; Gentil, F. (2003). Liste actualisée des espèces d’Annélides Polychètes présentes en Manche [An up to date list of polychaetous annelids from the English Channel]. Cah. Biol. Mar. 44(1): 67-95
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The parchment tube worm is considered a cosmopolitan species, occurring in shallow coastal habitats in temperate to tropical locations worldwide (e.g. Gray 1961; Schaffner 1990; Hsueh & Huang 1998). Worm tubes are generally found partially buried on shallow sand or mud flats, or on protected beaches around the low-tide line. The majority of the U-shaped tube is submerged in the surrounding sediment at depths up to 15 cm (Schaffner 1990).Indian River Lagoon (India River Lagoon) Distribution: Few published reports are available concerning populations of C. variopedatus in the India River Lagoon, but worms can be found throughout the lagoon in the sediments of tidal flats and sheltered beaches.
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

The parchment tube worm typically grows to lengths of 14 to 24 cm, or greater (e.g. Macginitie 1939; Ruppert & Barnes 1994). The tubes in which the worms live may measure up to 85 cm in length, with a diameter of 4 cm at the widest middle portion (Gray 1961). As the worm grows, it cuts a slit in the tube with spines located on one of its segments, and then adds more material to expand both the length and width of the tube (Fauchald & Jumars 1979). The lifespan of C. variopedatus varies with environmental conditions and other factors, but most specimens that have been studied live for a period of about one year or less (Thompson & Schaffner 2001).
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Several polychaetes are found in the sediments of the IRL, and some species construct tubes using various materials. However, the parchment tube worm can be distinguished from similar species mainly by the appearance and height of the tube openings that rise well above the surrounding sediment (Voss 1980).
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 672 specimens in 1 taxon.
Water temperature and chemistry ranges based on 230 samples.

Environmental ranges
  Depth range (m): -99 - 2170
  Temperature range (°C): -1.810 - 27.099
  Nitrate (umol/L): 0.086 - 29.932
  Salinity (PPS): 32.051 - 36.144
  Oxygen (ml/l): 3.123 - 7.134
  Phosphate (umol/l): 0.085 - 2.187
  Silicate (umol/l): 1.685 - 69.761

Graphical representation

Depth range (m): -99 - 2170

Temperature range (°C): -1.810 - 27.099

Nitrate (umol/L): 0.086 - 29.932

Salinity (PPS): 32.051 - 36.144

Oxygen (ml/l): 3.123 - 7.134

Phosphate (umol/l): 0.085 - 2.187

Silicate (umol/l): 1.685 - 69.761
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The tough permanent tubes are seen in sand and stone or shell gravel from low water to considerable depths, and in deeper water on rock, in fissures in rock and under boulders.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Some studies refer to parchment tube worms as filter feeders, while others assign the species to the 'suspension feeder' category. The method of food collection in C. variopedatus differs from that of other filter feeders. In order to draw clean water through the tube, remove wastes, and pump in planktonic food, the worm beats a series of three modified paddle-like body segments (notopodia) against the inner wall of the tube (Macginitie 1939; Wells & Dales 1951; Brown 1975; Fauchald & Jumars 1979; Ruppert & Barnes 1994). This motion creates flow that pulls water into the anterior opening of the U-shaped tube and pushes it out through the opposing end. A mucous film is secreted between the notopodia, which curves to form a bag-like filter that traps detritus and planktonic organisms such as diatoms, protozoans, and larger metazoan zooplankton (Fauchald & Jumars 1979). When the bag reaches a certain size, it is detached from the notopodia, rolled into a ball and carried to the mouth for consumption. The entire process may occur quite rapidly, depending on the size of the worm and the amount of suspended material entering the tube. A worm measuring 18 to 24 cm in length may produce a mucous film at a rate of 1 mm per second, forming individual food balls up to 3 mm in diameter (Ruppert & Barnes 1994).Predators: Little information is available detailing the predators of the parchment tube worm, but it is likely that C. variopedatus is preyed upon by a variety of large bottom-feeding fishes and crustaceans. Like many other sedentary marine organisms that cannot readily retreat, C. variopedatus has evolved some complex anti-predatory strategies. Chaetopterus is one of a few genera of polychaetes with separate specialized regions that can regenerate an entire body from a single segment (Ruppert & Barnes 1994). Overall, this ability is more common among worms with undifferentiated trunks. Following predation of one or more body parts, the remaining segment(s) supply the cells for the regeneration of other segments, appendages, and even the head in some instances. In order to deter a potential predator before an attack takes place, the parchment tube worm also has the ability to luminesce, or emit bright clouds of luminescent mucous from its tube (Martin & Anctil 1984).
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Parchment tube worms often share their borrows with a variety of organisms, including the commensal crabs, Pinnixa chaetopterana, Polyonyx gibbesi and P. bella (Gray 1961; Grove & Woodin 1996; Hsueh & Huang 1998; Grove et al. 2000). All these species likely gain considerable protection and food from the host worm, although some species are considered obligate associates; while others are facultative, choosing to live in association with the worm (Gray 1961).
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Details on the abundance of C. variopedatus in the IRL are scarce, but densities of over 1000 individuals m-2 were found for worm populations in the lower Chesapeake Bay at the height of the summer recruitment season (Thompson & Schaffner 2001). In other months, densities of about 30 to 60 individuals m-2 are more common (Schaffner 1990; Thompson & Schaffner 2001).Reproduction &
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Growth

Little information is available detailing the reproductive process for C. variopedatus. However, studies have shown that ovigerous females carry 150,000 to over one million eggs at a time (Thompson & Schaffner 2001). Spawning occurs in the summer for populations residing in Chesapeake Bay (Thompson & Schaffner 2001), but it is likely that the reproductive season of Florida populations is extended due to the warm temperate to subtropical climate. Larvae are planktonic, drifting and feeding in the water column before settling and building a permanent tube in the benthos (Fauchald & Jumars 1979).
  • Voss, GL. 1980. Seashore life of Florida and the Caribbean. Dover Publications, Inc. Mineola, NY. USA. 199 pp.
  • Brown, SC. 1975. Biomechanics of water-pumping by Chaetopterus variopedatus Renier. Skeletomusculature and kinematics. Biol. Bull. 149: 136-150.
  • Brown, SC, Bdzil, JB & HL Frisch. 1972. Responses of Chaetopterus variopedatus to osmotic stress, with a discussion of the mechanism of isoosmotic volume-regulation. Biol. Bull. 143: 278-295.
  • Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  • Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  • Grove, MW, Finelli, CM, Wethey, DS & SA Woodin. 2000. The effects of symbiotic crabs on the pumping activity and growth rates of Chaetopterus variopedatus. J. Exp. Mar. Biol. Ecol. 246: 31-52.
  • Grove, MW & SA Woodin. 1996. Conspecific recognition and host choice in a pea crab, Pinnixa chaetopterana (Brachyura: Pinnotheridae). Biol. Bull. 190: 359-366.
  • Hsueh, P & J Huang. 1998. Polyonyx bella, a new species (Decapoda: Anomura: Porcellanidae), from Taiwan, with notes on its reproduction and swimming behavior. J. Crust. Biol. 18: 332-336.
  • Macginitie, GE. 1939. The method of feeding of Chaetopterus. Biol. Bull. 77: 115-118.
  • Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
  • Nicol, JAC. 1954. Effect of external milieu on luminescence in Chaetopterus. J. Mar. Biol. Ass. U.K. 33: 173-175.
  • Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  • Schaffner, LC. 1990. Small-scale organism distributions and patterns of species diversity: evidence for positive interactions in an estuarine benthic community. Mar. Biol. Prog. Ser. 61: 107-117.
  • Thompson, ML & LC Schaffner. 2001. Population biology and secondary production of the suspension feeding polychaete Chaetopterus c.f. variopedatus: implications for benthic-pelagic coupling in lower Chesapeake Bay. Limnol. Oceanogr. 46: 1899-1907.
  • Wang, J-H, Kong, J, Li, W, Molchanova, V, Chikalovets, I, Belogortseva, N, Luk'yanov, P & Y-T Zheng. 2006. A beta-galactose-specific lectin isolated from the marine worm Chaetopterus variopedatus possesses anti-HIV-1 activity. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 142: 111-117.
  • Wells, GP & RP Dales. 1951. Spontaneous activity patterns in animal behavior: the irrigation of the burrow in the polychaetes Chaetopterus variopedatus Renier and Nereis diversicolor O.F. Müller. J. Mar. Biol. Ass. U.K. 29: 661-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaetopterus kagosimensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetopterus cautus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chaetopterus cf. luteus KJO-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CATAAAGATATTGGAACTCTCTATTTTATTTTTGCTATCTGAGCCGCAATAATTGGTACAGCACTTAGCCTTCTAATTCGAGCCGAGCTCGCTCAACCTGGCTCTCTTCTTGGCTCA---GATCAGCTCTACAATGTAATTGTTACAGCTCACGCCTTCGTAATAATTTTTTTCTTTGTTATACCTATGGCTATCGGCGGTTTCGGGAACTGACTTCTTCCCTTAATACTTGCTGCCCCGGACATAGCCTTTCCCCGGCTCAATAACATAAGTTTCTGGTTACTCCCTCCTTCCCTTACTCTCCTTCTTTCTTCATCCCTCGTTGAAACAGGTGCTGGAACTGGGTGAACTGTTTACCCCCCTCTCGCAGGTAACTTAGCTCATGCCGGCCCCTCAGTAGATCTTGCTATTTTCTCCCTTCATTTGGCGGGGATTTCTTCCATCCTTGGTGCCGTGAACTTCATATCAACTACTTTTAACATGCGCCACAGGGGAATGCTCATGGAGCGGATTCCTCTATTTGCCTGAGCTATCCTAATTACTGTAGTTCTCCTGCTCTTATCTCTCCCCGTACTTGCCGCTGCAATCACTATGCTTCTCACTGATCGTAATTTTAATACTTCCTTCTTCGACCCCGCAGGTGGGGGGGACCCTATTTTGTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetopterus cf. luteus KJO-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chaetopterus variopedatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCTCTCTTCTGGGCTCT---GACCAATTATATAATGTTATCGTTACTGCCCACGCTTTTGTAATAATTTTTTTCTTTGTTATACCAATGGCTATCGGCGGCTTTGGGAACTGGCTCTTACCTCTTATGTTGGCTGCCCCTGATATAGCCTTTCCTCGCTTAAATAATATAAGTTTCNGGTTATTACCCCCCTCTCTCACCCTCTTACTTTCTTCGTCCCTTGTAGAAACCGGAGCAGGAACCGGTTGAACAGTATACCCACCTCTGGCAGGGAATCTTGCACATGCCGGCCCTTCTGTTGATCTTGCTATTTTTTCTCTTCATCTAGCCGGTATCTCTTCGATTCTTGGGGCCGTTAACTTTATATCAACCACTTTTAACATACGGCATAACGGTATGCTCATAGAACGAATCCCATTATTTGCTTGAGCGATTTTAATTACTGTAGTTTTACTTCTTCTCTCACTCCCTGTTCTAGCAGCCGCAATTACCATACTCCTGACCGATCGGAACTTTAACACATCATTTTTTGATCCTGCTGGCGGGGGTGACCCCATCCTGTACCAACACCTATTCTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetopterus variopedatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at National Institute of Water and Atmospheric Research, Wellington
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chaetopterus variopedatus

Chaetopterus variopedatus is a species of parchment worm, a marine polychaete in the family Chaetopteridae. It is found worldwide. However, recent discoveries from molecular phylogeny analysis show that Chaetopterus variopedatus sensu Hartman (1959) is not a single species.

Polychaetes, or marine bristle worms, have elongated bodies divided into many segments. Each segment may bear setae (bristles) and parapodia (paddle-like appendages). Some species live freely, either swimming, crawling or burrowing, and these are known as "errant". Others live permanently in tubes, either calcareous or parchment-like, and these are known as "sedentary".

Description[edit]

C. variopedatus builds and lives permanently in a tough, flexible, papery U-shaped tube buried in soft substrate with both ends protruding like little chimneys. The worm itself is segmented, pale coloured and up to twenty-five centimetres long. The anterior end is short and has bristle-bearing segments and a shovel-like mouth.[1] The middle section bears parapodia. On the 12th segment these are modified into long wing-like structures which secrete mucus and form a bag. The parapodia on segments 13, 14 and 15 are fused into three paddle-shaped, piston-like structures, the purpose of which is to pump water through the tube. The water is drawn in through the anterior end and expelled through the posterior end,[1] passing through the fine mesh of the mucus bag where food particles get trapped. The mucus bag is later rolled up and passed by a conveyor belt of whipping hairs in the ciliated dorsal groove [2] to the mouth where it is swallowed whole.[3] The posterior half of the worm is segmented and tapers towards the rear, bearing appendages on each segment.[4]

Distribution and habitat[edit]

C. variopedatus has a cosmopolitan distribution, occurring in shallow coastal habitats in both temperate and tropical locations throughout the world.[1] It is plentiful around the coasts of Britain and Ireland but is absent from the east coast of England south of the Tees estuary. The tough permanent tubes are found buried in sand and gravel in the littoral and sub-littoral zones. At greater depths they are found adhering to bedrock, in crevices and under boulders.[4]

In New Zealand there have been many recent reports of the parchment-like tubes of Chaetopterus littering beaches, especially after storms. Since about 1995, large areas of shallow sea have been invaded by the worm, believed to be C. variopedatus. By covering the sandy bottom with a dense mat of tubes, the parchment worm makes life very difficult for the native bottom-dwelling fauna. Other marine worms, clams and starfish have been squeezed out, but the big-belly seahorse (Hippocampus abdominalis) has thrived as it finds extra prey in the tiny sea slaters and mysid shrimps it finds between the tubes and can anchor itself by its tail to prevent itself being swept away.[2]

Biology[edit]

A female C. variopedatus can produce and liberate a batch of 150,000 to 1 million eggs into the sea. After fertilisation, the developing larvae become part of the plankton, drifting and feeding for some weeks until they settle out.[5] The development of C. variopedatus follows an unusual pattern in that those segments destined to become part of the mid-body region have accelerated development as compared with the anterior segments. This heterochrony is not seen in other polychaete worms.[3]

Ecology[edit]

Several species of crabs have adopted the tubes of C. variopedatus as their home with Pinnixa chaetopterana, Polyonyx gibbesi and certain Pisidia species living almost exclusively within the tubes although they do not share a tube with each other.[3] It is likely that the crabs gain protection from predators within the tubes and possibly food from the host worm.[6]

Bottom-feeding fish and crustaceans probably prey on C. variopedatus but the worm is made less accessible by the fact that it never emerges from its tube which is safely buried beneath the surface of the substrate. If it becomes injured, this worm has the ability to regenerate its entire body from a single segment.[7] Another anti-predator strategy involves emitting a luminescent cloud of mucus from its tube.[8]

References[edit]

  1. ^ a b c Encyclopedia of Life
  2. ^ a b Invasion of the parchment worm
  3. ^ a b c Marine organisms database
  4. ^ a b Marine Life Information Network
  5. ^ Fauchald, K & PA Jumars. 1979. The diet of worms: a study of the polychaete feeding guilds. Oceanogr. Mar. Biol. Ann. Rev. 17: 193-284.
  6. ^ Gray, IE. 1961. Changes in abundance of the commensal crabs of Chaetopterus. Biol. Bull. 120: 353-359.
  7. ^ Ruppert, EE & RD Barnes. 1994. Invertebrate Zoology, 6th Edition. Saunders College Publishing. Orlando, FL. 1056 pp.
  8. ^ Martin, N & M Anctil. 1984. Luminescence control in the tube-worm Chaetopterus variopedatus: role of nerve cord and photogenic gland. Biol. Bull. 166: 583-593.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!