Overview

Comprehensive Description

Taxonomic History

Anochetus africanus var. madagascarensis Forel, 1887 PDF: 382 (w.) MADAGASCAR. AntCat AntWiki

Taxonomic history

Raised to species and senior synonym of Anochetus friederichsi: Brown, 1978c: 557.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Inner Seychelles: Mahé. Endemic to the Malagasy Subregion. Recorded from the Comoros (Grande Comore, Anjouan) and Madagascar.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

[[ worker ]]. Identique a la variete madagascariensis For., dont elle ne differe que par son ecaille, absolument entiere au sommet, sans trace d'echancrure. L'insecte est aussi un peu plus lisse et plus luisant.

 

Ilot Prune pres Tamatave, Madagascar, recolte par le Dr. Friederichs.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anochetus madagascarensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 136 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTTTATTTGCAATTTGATCTGGAATAATTGGATCTTCAATAAGAATATTAATTCGTTTAGAATTAGGAACATTAAATTCATTTATTTTAAATGATCAAATTTATAATTCATTGATTACTAGTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATTGGTGGATTTGGAAATTATTTAGTTCCATTAATATTAGGATCTCCTGATATGGCATATCCACGAATAAATAATATAAGATTTTGATTACTTCCACCATCTTTATTATTATTATTATCAAGAAGATTAATCTTTAATGGTGTTGGGACAGGATGAACAGTTTATCCTCCATTATCAAATAATATATATCATAATGGATTTTCAACAGATTTAGCAATTTTTTCTTTACATATTGCAGGAATATCATCTATTATAGGAGCAATTAATTTTATTTCAACAATTTTAAATATACATCATAAAAATTTATCTTTAGATAAAATTACTTTATTAGTTTGATCTATTTTAATTACAGCAATTTTATTATTATTATCTTTACCTGTTCTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATATTAATACATCGTTTTTTGATCCATCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anochetus madagascarensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 113
Specimens with Barcodes: 174
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!