Overview
Comprehensive Description
Taxonomic History
Taxonomic history
| Fisher & Smith, 2008 PDF: 12 (q.m.). |
| Raised to species and senior synonym of Anochetus friederichsi: Brown, 1978c: 557. |
Source:
AntWeb
Trusted
Distribution
Inner Seychelles: Mahé. Endemic to the Malagasy Subregion. Recorded from the Comoros (Grande Comore, Anjouan) and Madagascar.
Source:
AntWeb
Trusted
Physical Description
Diagnostic Description
[[ worker ]]. Identique a la variete madagascariensis For., dont elle ne differe que par son ecaille, absolument entiere au sommet, sans trace d'echancrure. L'insecte est aussi un peu plus lisse et plus luisant.
Ilot Prune pres Tamatave, Madagascar, recolte par le Dr. Friederichs.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Anochetus madagascarensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 136 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 136 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TATATTATATTTTTTATTTGCAATTTGATCTGGAATAATTGGATCTTCAATAAGAATATTAATTCGTTTAGAATTAGGAACATTAAATTCATTTATTTTAAATGATCAAATTTATAATTCATTGATTACTAGTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATTGGTGGATTTGGAAATTATTTAGTTCCATTAATATTAGGATCTCCTGATATGGCATATCCACGAATAAATAATATAAGATTTTGATTACTTCCACCATCTTTATTATTATTATTATCAAGAAGATTAATCTTTAATGGTGTTGGGACAGGATGAACAGTTTATCCTCCATTATCAAATAATATATATCATAATGGATTTTCAACAGATTTAGCAATTTTTTCTTTACATATTGCAGGAATATCATCTATTATAGGAGCAATTAATTTTATTTCAACAATTTTAAATATACATCATAAAAATTTATCTTTAGATAAAATTACTTTATTAGTTTGATCTATTTTAATTACAGCAATTTTATTATTATTATCTTTACCTGTTCTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATATTAATACATCGTTTTTTGATCCATCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Anochetus madagascarensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 113
Specimens with Barcodes: 174
Species With Barcodes: 1
Public Records: 113
Specimens with Barcodes: 174
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
