Overview

Distribution

northern Gaspe waters, lower St. Lawrence estuary; western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Cobscook Bay to Cape Hatteras
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 161 specimens in 1 taxon.
Water temperature and chemistry ranges based on 78 samples.

Environmental ranges
  Depth range (m): -0.5 - 1180
  Temperature range (°C): 7.531 - 15.727
  Nitrate (umol/L): 0.267 - 18.318
  Salinity (PPS): 31.692 - 39.033
  Oxygen (ml/l): 4.720 - 6.616
  Phosphate (umol/l): 0.088 - 1.153
  Silicate (umol/l): 1.352 - 16.001

Graphical representation

Depth range (m): -0.5 - 1180

Temperature range (°C): 7.531 - 15.727

Nitrate (umol/L): 0.267 - 18.318

Salinity (PPS): 31.692 - 39.033

Oxygen (ml/l): 4.720 - 6.616

Phosphate (umol/l): 0.088 - 1.153

Silicate (umol/l): 1.352 - 16.001
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dodecaceria concharum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GATATTGGAACACTATATCTTCTCCTTGGCACTTGATCTGGCCTAATCGGCACTTCTTGCAGCCTTCTTATTCGAATTGAACTTAGCCAACCCGGGGCATTCTTAGGAAAT---GACCAAATCTATAATGTCCTAGTCACCGCACACGCATTTTTAATAATTTTCTTCATAGTAATACCTATCTTTGTAGGGGGGTTTGGGAACTGACTCATCCCCCTTATACTAGCCGCCCCGGATATGGCCTTCCCCCGCCTTAACAACCTAAGACTTTGACTACTCCCCCCCGCACTCACGCTTCTTGTACTCTCCGCTTTAGTAGAACAAGGAGTCGGAACTGGCTGAACCGTCTACCCCCCATTAGCCGGCTGCACCGCCCATAGCGGACCTTCTGTTGATTTAGCAATCTTTTCCCTACATCTCGCTGGGGCCTCTTCAATTCTAGGCTCCCTAAACTTTCTAACTACAGTTTTTAATATACGACCCGACACCCTACTCGCTGAACGAATCCCTCTATTTGTATGATCCCTAGTCGTAACTGCCGTCCTACTAGTTTTATCTCTCCCTGTTCTAGCCGGAGCAATTACTATACTCTTAACAGATCGAAACCTAAACTCTTCCTTCTTTATCCCTGAAGGAGGAGGAGACCCCGTACTTTATCAACACTTATTTTGATTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dodecaceria concharum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!