Overview

Distribution

downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay to North Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 372 samples.

Environmental ranges
  Depth range (m): -99 - 1345
  Temperature range (°C): 7.163 - 24.086
  Nitrate (umol/L): 0.325 - 31.303
  Salinity (PPS): 31.893 - 36.325
  Oxygen (ml/l): 3.015 - 6.561
  Phosphate (umol/l): 0.110 - 1.990
  Silicate (umol/l): 0.756 - 20.923

Graphical representation

Depth range (m): -99 - 1345

Temperature range (°C): 7.163 - 24.086

Nitrate (umol/L): 0.325 - 31.303

Salinity (PPS): 31.893 - 36.325

Oxygen (ml/l): 3.015 - 6.561

Phosphate (umol/l): 0.110 - 1.990

Silicate (umol/l): 0.756 - 20.923
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clymenella torquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTATACTCAACAAATCATAAAGATATTGGAACAATATATTTTATACTAGGGACATGAGGAGGTCTATTAGGCACATCTATAAGACTATTAATCCGTGTTGAACTAGGACAACCAGGCCCATTCTTAGGCAGA---GACCAGTTGTATAACACTATTGTTACAGCCCATGCTTTTCTTATAATTTTTTTTATAGTAATACCTATTTTTATTGGGGGATTTGGGAACTGATTAGTACCACTTATACTGGGGGCACCGGATATGGCTTTCCCACGAATAAATAATATAAGATTTTGACTCTTACCACCATCTCTCACACTTCTATTAGCCAGAGCTGCTGTAGAAAAAGGAGTTGGAACAGGATGAACAGTATACCCACCTCTATCTAGAAATTTAGCTCATGCCGGCCCATCTGTAGATTTAGCCATCTTTTCTTTACATTTAGCAGGAGTATCAAGAATTTTGGGGGCAATTAATTTTATTACAACAGCTATTAATATACGATCTGAAGGCCTTCAACTAGAACGAATACCTTTATTTGTCTGATCTGTAAAAATTACTGCTATTCTATTACTTCTCTCACTGCCAGTGTTAGCAGGCGCAATTACTATACTTTTAACAGACCGAAATCTAAACACAGCATTCTTTGACCCAGCAGGAGGCGGCGACCCTATTCTTTACCAACACTTATTCTGATTCTTCGGGCACCCTGAAGTATATATTCTTATTTTACCTGCATTCGGTGCTATTTCACACATTGTTGCACACCATAGAGGTAAACCGGAACCATTTGGAACCTTAGGAATAATCTATGCTATATCTGGAATTGGTGTTCTAGGGTTTATTGTATGGGCTCATCATATATTTACAGTAGGATTAGATGTCGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clymenella torquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!