Overview

Distribution

Atlantic, Canada, Caribbean Sea, Cobscook Bay, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Irish Exclusive economic Zone, North Sea, North West Atlantic, Northumberland, Puerto Rico, South Coast of England, United Kingdom Exclusive Economic Zone, USA, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay to North Carolina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores and seagrass beds.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 372 samples.

Environmental ranges
  Depth range (m): -99 - 1345
  Temperature range (°C): 7.163 - 24.086
  Nitrate (umol/L): 0.325 - 31.303
  Salinity (PPS): 31.893 - 36.325
  Oxygen (ml/l): 3.015 - 6.561
  Phosphate (umol/l): 0.110 - 1.990
  Silicate (umol/l): 0.756 - 20.923

Graphical representation

Depth range (m): -99 - 1345

Temperature range (°C): 7.163 - 24.086

Nitrate (umol/L): 0.325 - 31.303

Salinity (PPS): 31.893 - 36.325

Oxygen (ml/l): 3.015 - 6.561

Phosphate (umol/l): 0.110 - 1.990

Silicate (umol/l): 0.756 - 20.923
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clymenella torquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTATACTCAACAAATCATAAAGATATTGGAACAATATATTTTATACTAGGGACATGAGGAGGTCTATTAGGCACATCTATAAGACTATTAATCCGTGTTGAACTAGGACAACCAGGCCCATTCTTAGGCAGA---GACCAGTTGTATAACACTATTGTTACAGCCCATGCTTTTCTTATAATTTTTTTTATAGTAATACCTATTTTTATTGGGGGATTTGGGAACTGATTAGTACCACTTATACTGGGGGCACCGGATATGGCTTTCCCACGAATAAATAATATAAGATTTTGACTCTTACCACCATCTCTCACACTTCTATTAGCCAGAGCTGCTGTAGAAAAAGGAGTTGGAACAGGATGAACAGTATACCCACCTCTATCTAGAAATTTAGCTCATGCCGGCCCATCTGTAGATTTAGCCATCTTTTCTTTACATTTAGCAGGAGTATCAAGAATTTTGGGGGCAATTAATTTTATTACAACAGCTATTAATATACGATCTGAAGGCCTTCAACTAGAACGAATACCTTTATTTGTCTGATCTGTAAAAATTACTGCTATTCTATTACTTCTCTCACTGCCAGTGTTAGCAGGCGCAATTACTATACTTTTAACAGACCGAAATCTAAACACAGCATTCTTTGACCCAGCAGGAGGCGGCGACCCTATTCTTTACCAACACTTATTCTGATTCTTCGGGCACCCTGAAGTATATATTCTTATTTTACCTGCATTCGGTGCTATTTCACACATTGTTGCACACCATAGAGGTAAACCGGAACCATTTGGAACCTTAGGAATAATCTATGCTATATCTGGAATTGGTGTTCTAGGGTTTATTGTATGGGCTCATCATATATTTACAGTAGGATTAGATGTCGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clymenella torquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!