Overview
Distribution
Atlantic, Canada, Caribbean Sea, Cobscook Bay, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Irish Exclusive economic Zone, North Sea, North West Atlantic, Northumberland, Puerto Rico, South Coast of England, United Kingdom Exclusive Economic Zone, USA, Wimereux
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Eno, N.C.; Clark, R.A.; Sanderson, W.G. (Ed.) (1997). Non-native marine species in British waters: a review and directory. Joint Nature Conservation Committee: Peterborough, UK. ISBN 1-86107-442-5. 152 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9281
-
Dauvin, J.-C.; Dewarumez, J.-M.; Gentil, F. (2003). Liste actualisée des espèces d’Annélides Polychètes présentes en Manche [An up to date list of polychaetous annelids from the English Channel]. Cah. Biol. Mar. 44(1): 67-95
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1138
-
Bellan, G. (2001). Polychaeta, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 214-231
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1429
-
Streftaris, N.; Zenetos, A.; Papathanassiou, E. (2005). Globalisation in marine ecosystems: the story of non-indigenous marine species across European seas. Oceanogr. Mar. Biol. Ann. Rev. 43: 419-453
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9271
-
Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=3072
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Miloslavich P, Díaz JM, Klein E, Alvarado JJ, Díaz C, et al. (2010) Marine Biodiversity in the Caribbean: Regional Estimates and Distribution Patterns. PLoS ONE 5(8): e11916. doi:10.1371/journal.pone.0011916
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145466
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
Trusted
downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay to North Carolina
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
Known from rocky shores and seagrass beds.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
Trusted
infralittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 1135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 372 samples.
Environmental ranges
Depth range (m): -99 - 1345
Temperature range (°C): 7.163 - 24.086
Nitrate (umol/L): 0.325 - 31.303
Salinity (PPS): 31.893 - 36.325
Oxygen (ml/l): 3.015 - 6.561
Phosphate (umol/l): 0.110 - 1.990
Silicate (umol/l): 0.756 - 20.923
Graphical representation
Depth range (m): -99 - 1345
Temperature range (°C): 7.163 - 24.086
Nitrate (umol/L): 0.325 - 31.303
Salinity (PPS): 31.893 - 36.325
Oxygen (ml/l): 3.015 - 6.561
Phosphate (umol/l): 0.110 - 1.990
Silicate (umol/l): 0.756 - 20.923
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 372 samples.
Environmental ranges
Depth range (m): -99 - 1345
Temperature range (°C): 7.163 - 24.086
Nitrate (umol/L): 0.325 - 31.303
Salinity (PPS): 31.893 - 36.325
Oxygen (ml/l): 3.015 - 6.561
Phosphate (umol/l): 0.110 - 1.990
Silicate (umol/l): 0.756 - 20.923
Graphical representation
Depth range (m): -99 - 1345
Temperature range (°C): 7.163 - 24.086
Nitrate (umol/L): 0.325 - 31.303
Salinity (PPS): 31.893 - 36.325
Oxygen (ml/l): 3.015 - 6.561
Phosphate (umol/l): 0.110 - 1.990
Silicate (umol/l): 0.756 - 20.923
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Clymenella torquata
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 11 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 11 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATGCGATGATTATACTCAACAAATCATAAAGATATTGGAACAATATATTTTATACTAGGGACATGAGGAGGTCTATTAGGCACATCTATAAGACTATTAATCCGTGTTGAACTAGGACAACCAGGCCCATTCTTAGGCAGA---GACCAGTTGTATAACACTATTGTTACAGCCCATGCTTTTCTTATAATTTTTTTTATAGTAATACCTATTTTTATTGGGGGATTTGGGAACTGATTAGTACCACTTATACTGGGGGCACCGGATATGGCTTTCCCACGAATAAATAATATAAGATTTTGACTCTTACCACCATCTCTCACACTTCTATTAGCCAGAGCTGCTGTAGAAAAAGGAGTTGGAACAGGATGAACAGTATACCCACCTCTATCTAGAAATTTAGCTCATGCCGGCCCATCTGTAGATTTAGCCATCTTTTCTTTACATTTAGCAGGAGTATCAAGAATTTTGGGGGCAATTAATTTTATTACAACAGCTATTAATATACGATCTGAAGGCCTTCAACTAGAACGAATACCTTTATTTGTCTGATCTGTAAAAATTACTGCTATTCTATTACTTCTCTCACTGCCAGTGTTAGCAGGCGCAATTACTATACTTTTAACAGACCGAAATCTAAACACAGCATTCTTTGACCCAGCAGGAGGCGGCGACCCTATTCTTTACCAACACTTATTCTGATTCTTCGGGCACCCTGAAGTATATATTCTTATTTTACCTGCATTCGGTGCTATTTCACACATTGTTGCACACCATAGAGGTAAACCGGAACCATTTGGAACCTTAGGAATAATCTATGCTATATCTGGAATTGGTGTTCTAGGGTTTATTGTATGGGCTCATCATATATTTACAGTAGGATTAGATGTCGACACACGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Clymenella torquata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Trusted
Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

