Overview

Brief Summary

Living Material

This worm lives in a tube fashioned of sand grains, the tubes are in a vertical position, in the sand of inter-tidal regions, and at Beaufort, N. C., are often found in association with the similar tubes of Axiothella mucosa, another tubicolous annelid (Bookhout and Horn, 1949).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

This worm lives in a tube fashioned of sand grains, the tubes are in a vertical position, in the sand of inter-tidal regions, and at Beaufort, N. C., are often found in association with the similar tubes of Axiothella mucosa, another tubicolous annelid (Bookhout and Horn, 1949).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay to North Carolina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay to North Carolina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

infralittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 372 samples.

Environmental ranges
  Depth range (m): -99 - 1345
  Temperature range (°C): 7.163 - 24.086
  Nitrate (umol/L): 0.325 - 31.303
  Salinity (PPS): 31.893 - 36.325
  Oxygen (ml/l): 3.015 - 6.561
  Phosphate (umol/l): 0.110 - 1.990
  Silicate (umol/l): 0.756 - 20.923

Graphical representation

Depth range (m): -99 - 1345

Temperature range (°C): 7.163 - 24.086

Nitrate (umol/L): 0.325 - 31.303

Salinity (PPS): 31.893 - 36.325

Oxygen (ml/l): 3.015 - 6.561

Phosphate (umol/l): 0.110 - 1.990

Silicate (umol/l): 0.756 - 20.923
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Stages of Development

The larva is a free-swimming trochophore, reported to be similar to the trochophore of Amphitrite.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Later Stages of Development

The larva is a free-swimming trochophore, reported to be similar to the trochophore of Amphitrite.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Fertilization and Cleavage

The sperm enters after the first maturation spindle has formed, and the polar bodies remain to mark the animal pole (Mead, 1897). Cleavage is equal and spiral, and no polar lobes are formed. Gastrulation is probably by epiboly. In general, the development is very similar to that of Amphitrite, according to Mead; see Figures 65 to 88 in his paper (1897).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The egg measures 150 microns in diameter. It is practically spherical, and is very opaque because of the large amount of yellow yolk. A closely fitting, thin, smooth membrane is present (Mead, 1897).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

At times, the animals are abundant, but the number seems to fluctuate widely from year to year. Since the breeding season apparently is very short, it is advisable to collect large numbers of the worms immediately before the onset of the breeding season.

Burbanck et al. ( 1956) report that Clymenella was regularly collected at Rand's Harbor, Mass., over a six-year period.

According to Mead (1897), all mature individuals spawn during a restricted two- or three-day period which occurs between the latter part of April and the middle of May.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fertilization and Cleavage

The sperm enters after the first maturation spindle has formed, and the polar bodies remain to mark the animal pole (Mead, 1897). Cleavage is equal and spiral, and no polar lobes are formed. Gastrulation is probably by epiboly. In general, the development is very similar to that of Amphitrite, according to Mead; see Figures 65 to 88 in his paper (1897).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The egg measures 150 microns in diameter. It is practically spherical, and is very opaque because of the large amount of yellow yolk. A closely fitting, thin, smooth membrane is present (Mead, 1897).

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

At times, the animals are abundant, but the number seems to fluctuate widely from year to year. Since the breeding season apparently is very short, it is advisable to collect large numbers of the worms immediately before the onset of the breeding season.

Burbanck et al. ( 1956) report that Clymenella was regularly collected at Rand's Harbor, Mass., over a six-year period.

According to Mead (1897), all mature individuals spawn during a restricted two- or three-day period which occurs between the latter part of April and the middle of May.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Rate of Development

No precise information is available.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rate of Development

No precise information is available.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clymenella torquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTATACTCAACAAATCATAAAGATATTGGAACAATATATTTTATACTAGGGACATGAGGAGGTCTATTAGGCACATCTATAAGACTATTAATCCGTGTTGAACTAGGACAACCAGGCCCATTCTTAGGCAGA---GACCAGTTGTATAACACTATTGTTACAGCCCATGCTTTTCTTATAATTTTTTTTATAGTAATACCTATTTTTATTGGGGGATTTGGGAACTGATTAGTACCACTTATACTGGGGGCACCGGATATGGCTTTCCCACGAATAAATAATATAAGATTTTGACTCTTACCACCATCTCTCACACTTCTATTAGCCAGAGCTGCTGTAGAAAAAGGAGTTGGAACAGGATGAACAGTATACCCACCTCTATCTAGAAATTTAGCTCATGCCGGCCCATCTGTAGATTTAGCCATCTTTTCTTTACATTTAGCAGGAGTATCAAGAATTTTGGGGGCAATTAATTTTATTACAACAGCTATTAATATACGATCTGAAGGCCTTCAACTAGAACGAATACCTTTATTTGTCTGATCTGTAAAAATTACTGCTATTCTATTACTTCTCTCACTGCCAGTGTTAGCAGGCGCAATTACTATACTTTTAACAGACCGAAATCTAAACACAGCATTCTTTGACCCAGCAGGAGGCGGCGACCCTATTCTTTACCAACACTTATTCTGATTCTTCGGGCACCCTGAAGTATATATTCTTATTTTACCTGCATTCGGTGCTATTTCACACATTGTTGCACACCATAGAGGTAAACCGGAACCATTTGGAACCTTAGGAATAATCTATGCTATATCTGGAATTGGTGTTCTAGGGTTTATTGTATGGGCTCATCATATATTTACAGTAGGATTAGATGTCGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Clymenella torquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Procuring Gametes

Eggs are deposited on the surface of the sand, at the mouth of the tube. They may be left in sea water for several hours before insemination.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

Mature females have eggs which show through the body wall during the breeding season. The sexes should be segregated and the females placed in an aquarium which is supplied with sand. New tubes are rapidly built by the worms.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Gametes

Eggs are deposited on the surface of the sand, at the mouth of the tube. They may be left in sea water for several hours before insemination.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

Mature females have eggs which show through the body wall during the breeding season. The sexes should be segregated and the females placed in an aquarium which is supplied with sand. New tubes are rapidly built by the worms.

  • Bookhout, C. G., And E. C. Hoxn, 1949. The development of Axiothella mucosa (Andrews). J. Morph., 84: 145-183.
  • Burbanck, W. D., M. E. Pierce And G. C. Whiteley, Jr., 1956. A study of the bottom fauna of Rand's Harbor, Massachusetts: An application of the ecotone concept. Ecol. Monog., 26: 213-243.
  • Mead, A. D., 1894. Preliminary account of the cell lineage of Amphitrite and other annelids. J. Morph., 9: 465-473.
  • Mead, A. D., 1897. The early development of marine annelids. J. Morph., 13: 227-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!