Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0 - 181.5
  Temperature range (°C): 9.435 - 12.473
  Nitrate (umol/L): 6.725 - 23.391
  Salinity (PPS): 31.893 - 33.743
  Oxygen (ml/l): 3.276 - 6.561
  Phosphate (umol/l): 0.820 - 1.808
  Silicate (umol/l): 7.986 - 24.907

Graphical representation

Depth range (m): 0 - 181.5

Temperature range (°C): 9.435 - 12.473

Nitrate (umol/L): 6.725 - 23.391

Salinity (PPS): 31.893 - 33.743

Oxygen (ml/l): 3.276 - 6.561

Phosphate (umol/l): 0.820 - 1.808

Silicate (umol/l): 7.986 - 24.907
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyllochaetopterus prolifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNACTATACTTTATTTTTGCAACATGGTCCGCAATAGTTGGCCTTGCCTTAAGCTTACTAATCCGAGTAGAGCTCGCTCAGCCCGGCCCTTTCCTTGGGTCAGACCAGCTTTACAATGTAATTGTTACGGCCCACGCATTCGTAATGATTTTCTTTTTTGTTATGCCAATAGCAATTGGTGGGTTTGGGAATTGACTCCTCCCCTTAATGCTTGGCGCACCTGATATATCTTTTCCACGCCTAAACAACATAAGATTTTGACTTCTCCCCCCCGCACTATCACTACTTCTTGCTTCTGCCCTAGTAGAAAGGGGAGTGGGAACAGGATGGACTGTCTACCCGCCTCTTGCTGCAAATCTTGCCCATGCAGGACCCTCTGTAGACTTAGGAATTTTCTCCCTCCATTTAGCAGGAATCTCCTCTATCCTTGGTGCTATCAACTTTATTTCAACAGTGCGAAACATGCGAGTAGAAGGAATCCAAAGGGGACGAATGCCACTATTTGTCTGGGCCACCCTAATTACAGTAATTCTTTTACTTCTTTCCCTCCCCGTTCTGGCCGCAGCAATCACCATGTTACTAACAGATCGAAATTTTAACACCTCCTTTTTTGACCCTTCAGGGGGAGGAGACCCTATTTTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllochaetopterus prolifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!