Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.
Environmental ranges
Depth range (m): 0 - 181.5
Temperature range (°C): 9.435 - 12.473
Nitrate (umol/L): 6.725 - 23.391
Salinity (PPS): 31.893 - 33.743
Oxygen (ml/l): 3.276 - 6.561
Phosphate (umol/l): 0.820 - 1.808
Silicate (umol/l): 7.986 - 24.907
Graphical representation
Depth range (m): 0 - 181.5
Temperature range (°C): 9.435 - 12.473
Nitrate (umol/L): 6.725 - 23.391
Salinity (PPS): 31.893 - 33.743
Oxygen (ml/l): 3.276 - 6.561
Phosphate (umol/l): 0.820 - 1.808
Silicate (umol/l): 7.986 - 24.907
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 10 samples.
Environmental ranges
Depth range (m): 0 - 181.5
Temperature range (°C): 9.435 - 12.473
Nitrate (umol/L): 6.725 - 23.391
Salinity (PPS): 31.893 - 33.743
Oxygen (ml/l): 3.276 - 6.561
Phosphate (umol/l): 0.820 - 1.808
Silicate (umol/l): 7.986 - 24.907
Graphical representation
Depth range (m): 0 - 181.5
Temperature range (°C): 9.435 - 12.473
Nitrate (umol/L): 6.725 - 23.391
Salinity (PPS): 31.893 - 33.743
Oxygen (ml/l): 3.276 - 6.561
Phosphate (umol/l): 0.820 - 1.808
Silicate (umol/l): 7.986 - 24.907
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Phyllochaetopterus prolifica
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 7 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 7 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNNNNACTATACTTTATTTTTGCAACATGGTCCGCAATAGTTGGCCTTGCCTTAAGCTTACTAATCCGAGTAGAGCTCGCTCAGCCCGGCCCTTTCCTTGGGTCAGACCAGCTTTACAATGTAATTGTTACGGCCCACGCATTCGTAATGATTTTCTTTTTTGTTATGCCAATAGCAATTGGTGGGTTTGGGAATTGACTCCTCCCCTTAATGCTTGGCGCACCTGATATATCTTTTCCACGCCTAAACAACATAAGATTTTGACTTCTCCCCCCCGCACTATCACTACTTCTTGCTTCTGCCCTAGTAGAAAGGGGAGTGGGAACAGGATGGACTGTCTACCCGCCTCTTGCTGCAAATCTTGCCCATGCAGGACCCTCTGTAGACTTAGGAATTTTCTCCCTCCATTTAGCAGGAATCTCCTCTATCCTTGGTGCTATCAACTTTATTTCAACAGTGCGAAACATGCGAGTAGAAGGAATCCAAAGGGGACGAATGCCACTATTTGTCTGGGCCACCCTAATTACAGTAATTCTTTTACTTCTTTCCCTCCCCGTTCTGGCCGCAGCAATCACCATGTTACTAACAGATCGAAATTTTAACACCTCCTTTTTTGACCCTTCAGGGGGAGGAGACCCTATTTTATACCAACACCTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Phyllochaetopterus prolifica
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
