Overview

Comprehensive Description

Introduction

The giant squid, Architeuthis dux, was described by Steenstrup in Harting in 1860. It is the only species in the genus Architeuthidae.Giant squid are the largest known cephalopod. Colossal squid (Mesonychoteuthis hamiltoni Robson, 1935) may reach greater lengths or mass but no complete, fully grown specimens have ever been recorded.In the past, giant squid were often misreported as reaching lengths of up to 20 metres. Scientists now believe that adult females may only reach a total length of 15m, with adult males reaching up to 10m in length.Most of the giant squid material in museum collections comes from specimens that have been found washed up on beaches or come from the stomach contents of sperm whales which feed on giant squid.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Giant squid are distributed in all the oceans of the world, usually in association with continental and island slopes. Concentrations of species found range from the North Atlantic Ocean, especially Newfoundland, Norway, northern British Isles and the oceanic islands of the Azores and Madeira; the South Atlantic in southern African waters; the North Pacific around Japan, and the southwestern Pacific around New Zealand and Australia; circumglobal in the Southern Ocean. Specimens are rare from tropical and high polar latitudes.(Forch 1998)

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Mexico, New Zealand Exclusive Economic Zone, North Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sightings

First photographs
The first photographs of a live giant squid in its natural habitat were taken by Tsunemi Kubodera and Kyoichi Mori on 30 September 2004 and released to the world in their 2005 paper. The photographs were taken in an area that was a known sperm whale hunting ground. In order to get the images they dropped a 900m line baited with squid and shrimp which was attached to a camera. Eventually a large squid attacked the baited line and snagged its tentacle. The camera took over 500 photos before the squid managed to break free after 4 hours but the squid's tentacle remained attached to the lure. DNA tests confirmed that the animal was a giant squid.

Video footage
On 4 December 2006 an adult giant squid specimen was recorded on video in the waters around the Ogasawara Islands, 1,000km (620 miles) south of Tokyo, by researchers from the National Science Museum of Japan led by Tsunemi Kubodera. The specimen was about 7m long and weighed 50kg (110lb).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locomotion feeding predators

Locomotion
The giant squid gets oxygen from the water using 2 large gills in its mantle. Water is pumped over the gills by expanding the mantle and then pushed out via the funnel. The squid uses this expelled water as one method of locomotion, in combination with pulsing the fins on the mantle.

Feeding
Studies of stomach contents have shown that giant squid feed on:

Predators
The only known predators of adult giant squid are:It has been theorised, however, that sleeper sharks may only feed on dead individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat

Global distribution
The exact distribution of giant squid is unknown but specimens have been found in all of the world's oceans.Concentrations can be found in the:
  • North Atlantic Ocean - especially Newfoundland, Norway, the northern British Isles and the oceanic islands of the Azores and Madeira
  • South Atlantic in southern African waters
  • North Pacific around Japan
  • South-western Pacific around New Zealand and Australia
  • Southern Ocean (circumglobal)
Specimens are rare from tropical and high polar latitudes.

Vertical distribution
Their vertical distribution is also unknown but their occurrence in the zone of 200 to over 1200 metres is not unrealistic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Architeuthidae are the largest known cephalopods, the largest known mollusks and probably the largest invertebrates ever known to exist in the oceans. Architeuthidae have been recorded as long as 60 feet in total length, most of the specimens that have been found are really in the 35-45 foot range. There are still many which range from about 20 to 30 feet in length. The total length includes the body, the head, the arms, and the two long feeding tentacles. These feeding tentacles are much longer than the rest of the body. The heaviest animals weigh about a ton, but most of the time they are a thousand pounds or less.

These giant squid also have the largest eyes out of any animal in the world. The eyes of the giant squid can be as big as a human's head. Most deep-sea animals have very large eyes so they can gather the small amounts of light that are available in the deep depths of the ocean. They might even be able to see bioluminescent light.

The Architeuthidae posses two tentacles that average about 10-12 meters in length. These tentacles have many suckers on the tips, called clubs. The tentacular clubs are narrow and have suckers, which are sub-spherical cups lined with sharp, finely serrated rings of chitin, in four longitudinal rows. These suckers cover only the inner surface of the arms and tentacles. These tentacular clubs are divided into distinct carpus, manus and dactylus. The manus has enlarged suckers along medial two rows. The suckers on the tentacles, and the arms, are not known to be any bigger than about five to five and a half centimeters. The carpal region has a dense cluster of suckers, in six to seven irregular, transverse rows.

The Architeuthidae also have fins that are proportionally small, ovoid, and without free anterior lobes. The fins at the rear of the mantle, are used to help the squid move by gentle, rhythmic pulses of water pushed out of the mantle cavity throughout the funnel.

They also have eight arms with suckers in two longitudinal rows. At the end of the arms they have a parrot-like beaks at the base. Another characteristic of the squid is that they have buccal connectives that attach to the dorsal borders of arms.

Giant squid contain the dark, sepia-colored ink that we associate with the smaller, more familiar squid.

They have the two, very large gills resting inside the mantle cavity. The squid are able to breath and move quickly by expanding the mantle cavity by contracting sets of muscles within the mantle. The water fills the expanded space, the muscles relax, and the elastic mantle then snaps back to a smaller size, jetting water out through the funnel. The jet of water closes the flaps on either side of the squid's head so water can exit only through the funnel.

The nervous system of the squids are very extensive and they even also have a complex brain. For this reason they are under extensive research. The circulatory system is closed which is a distinct characteristic of the squid.(Portner, et al 1994) (Forch 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology



Mantle
The body of a squid is also referred to as the mantle. It houses the squid's:
  • digestive, reproductive and respiratory systems
  • ink sac
  • pen, or gladius
The giant squid has a pair of fins at the tip of the mantle.

Head
Next to the mantle is the head which contains the:
  • 2 eyes
  • doughnut-shaped brain
  • beak


Beak
Giant squid have a parrot-like beak that
  • lies at the end of the head in between the 8 arms and 2 tentacles
  • is made up of chitin and cross-linked proteins
  • is used to kill prey and to tear it into pieces small enough to ingest


Eyes
It was previously thought that giant squid had the largest eye of any living species but this record is now held by the colossal squid (Mesonychoteuthis hamiltoni Robson, 1935) which has an eye with a diameter of around 27cm. The 2 eyes in the giant squid contain a hard lens which is focused through movement, like a camera, rather than changing shape as the lens in the human eye does.

Arms and tentacles
Giant squid, like most squid, have:
  • 8 shorter arms covered with 2 rows of suckers
  • 2 longer tentacles with 4 rows of suckers called the tentacle club at the end of them
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

No one really knows where giant squid live because no one has seen one alive in its natural habitat. Only recent research has indicated where this habitat might be. It is in the deep sea, perhaps between 200 and 1000 meters in depth, and it is possibly in association with the bottom of the sea rather than in mid-water. On the other hand, specimens that have been captured in nets sometimes come from mid-water.

Work done by Dr. Ole Brix, of the University of Bergen, indicated the blood of squids does not carry oxygen very well at higher temperatures. A squid will actually suffocate in warm water. Warm water will cause a giant squid to rise to the surface and not be able to get back down. So the giant squid are probably more likely to be found in cooler water. (Forch 1998) (Banister and Campbell 1985)

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 475 - 475
  Temperature range (°C): 8.806 - 8.806
  Nitrate (umol/L): 28.707 - 28.707
  Salinity (PPS): 35.012 - 35.012
  Oxygen (ml/l): 2.827 - 2.827
  Phosphate (umol/l): 1.817 - 1.817
  Silicate (umol/l): 17.042 - 17.042
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

For many years, nobody knew what the giant squid utilized for food. This is because they have never really been observed in the wild. Some recent studies on dead individuals have shown that giant squid eat deep-sea fishes, such as orange ruffie, and hokie. They also eat other types of deep-sea squids, but not Architeuthis, the giant squid.

As large as these animals are, they would probably be able to capture almost anything, maybe even whales(see comments)! They capture their prey by using their two long feeding tentacles. The tentacles are shot out to grip the prey. The suckers on the tips of tentacles grab hold of the prey and the tentacles contract, bringing the prey to the arms. The arms then further subdue the prey, pulling it to the strong, sharp beaks. The beaks are operated by a massive set of muscles that allow them to bite through just about anything the squid might capture. But the giant squid's bite-sized pieces of food need further shredding before being digested. The tongue is equipped with an organ known as the radula, which is loaded with rows of small, file-like teeth. The radula further shreds the meal before the tongue pushes it down the esophagus to the digestive organs.

There are very few predators of the adult giant squid. The best and probably only one is the sperm whale. As babies and juveniles, they have many pedators, mostly deep sea fishes. Once giant squid get beyond a certain size, they have outgrown the size of most of their potential predators. Sperm whales grow to 40-50 feet in length, but they weigh 30-40 tons. So even though a giant squid is huge, it is not big enough to escape or to fight with a sperm whale. Most of the time the sperm whale wins. This is evident in the number of giant squid found in the stomach of the sperm whale. (Forch 1998) (Banister and Campbell 1985)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The reproduction of Architeuthis is not well known. Hypotheses are based on observations of the sexual characteristics in dead Architeuthis and from the knowledge of other squid

Females produce enormous quantities of whitish to cream-colored eggs, about .5-1.4 mm long and .3-.7 mm wide, depending on the stage of their maturity. One female had over 5000 gm(over 11 pounds) of eggs in her ovary, well in excess of a million eggs. As in most oegopsids, females have a single median ovary in the posterior end of the mantle cavity, paired, convoluted oviducts along with mature eggs pass, then exit through the oviducal glands, and large nidamental glands that produce quantities of gelatinous material. Whether the eggs are laid into a large gelatinous matrix, as in most of the large oceanic squids or are released individually, is unknown, although the large nidamental glands suggest the former method.

Males tend to reach sexual maturity at a smaller size than do females. The two ventral arms are reported to be modified into transfering the spermatophores to the female. As in most other cephalopods, the single, posterior testis produces sperm that move into a complex system of glands that manufacture the spermatophores. These are stored in the elongate sac, or Needham's sac from which they are expelled during mating. The Needham's sac of fully mature males is packed with hundreds of spermatophores. Needham's sac terminates in the penis. The penis is so elongate that it extends anteriorly beyond the mantle opening. While mating has not been observed and the exact role of the penis is uncertain, some females have been found with spermatangia, the sperm-containing sacs of the spermatophore, embedded in the tissue around the bases of the arms and the head.

Cephalopods are known to be very fast growing animals. Some species of small, shallow water forms reach sexual maturity in 6-8 months, and most species about which growth, age and maturity data are available reach reproductive capacity within 12-18 months. Many of the specimens of Architeuthis that have been recovered have been mature, especially the females. But the age at maturity of Architeuthis is not known with certanity. One study suggests that adult size is attained within 3 years. Even at the rapid growth rate expected in cephalopods, the attainment of a mass of 500 kg or more in fewer than 3 years is impressive.

(Nesis 1987)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Architeuthis dux

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCPH776-09|FJ429092|Architeuthis dux| ATGCGATGACTATTTTCTACAAATCACAAAGATATTGGTACACTATACTTTATTTTCGGTATTTGAGCAGGACTTCTAGGAACCTCCTTA---AGATTAATAATTCGTACTGAATTAGGACAACCAGGGTCATTATTAAACGAT---GACCAACTATATAATGTAGTAGTTACTGCCCATGGTTTCATTATAATTTTCTTCTTAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTAATA---TTAGGAGCACCCGATATAGCTTTTCCACGAATAAATAACATAAGATTCTGATTACTACCCCCTTCCTTAACACTACTTCTAGCTTCTTCAGCCGTAGAGAGAGGGGCTGGAACAGGATGAACAGTTTATCCCCCTTTATCTAGAAATCTCTCCCACGCGGGCCCATCAGTAGACTTA---GCCATTTTCTCACTTCATTTAGCAGGGGTATCTTCCATTTTAGGAGCCATTAACTTTATTACAACAATCTTAAATATACGATGAGAAGGTCTACAAATAGAACGTTTACCTCTATTTGCCTGATCCGTATTTATTACCGCAATCCTACTACTCCTATCCTTACCTGTACTAGCAGGG---GCTATTACAATATTACTAACTGACCGAAACTTTAATACTACTTTTTTTGACCCAAGGGGAGGTGGAGACCCCATCCTATACCAACACCTATTCTGATTTTTTGGACACCCAGAAGTCTATATTTTAATTCTTCCAGCTTTTGGTATTATTTCTCATATTGTTTCCCATCACTCTTTTAAAAAA---GAAATCTTTGGAGCCTTAGGAATAATCTATGCAATACTATCAATTGGGCTTCTAGGTTTCATTGTATGAGCCCACCACATATTCACAGTCGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Architeuthis dux

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 16
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

The number of individuals of this species is unknown.(Forch 1998)

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

As of right now, there really are no adverse effects on humans. We just recently found out it existed! The only minor problem it presents is that it can get entangled in fishing nets, but that itself is not a serious problem. (Nesis 1987)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Since not much is known, it is hard to tell how important it is to humans. It could be an essential part of the food chain, and if it is disrupted it could hurt the whales, for which we do have uses. The squid and other cephalopods have a very distinct and elaborate nervous system and brain. The giant squid could help us understand and learn more about nervous systems, maybe even ours. (Nesis 1987, Gilbert, et al 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!