Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 5 - 8
  Temperature range (°C): 25.420 - 25.420
  Nitrate (umol/L): 0.184 - 0.184
  Salinity (PPS): 35.073 - 35.073
  Oxygen (ml/l): 4.694 - 4.694
  Phosphate (umol/l): 0.179 - 0.179
  Silicate (umol/l): 4.026 - 4.026

Graphical representation

Depth range (m): 5 - 8
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyllidia elegans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTCTTTGGTATATGGTGTGGTCTTTTGGGAACAGGTTTAAGATTACTAATTCGTTTTGAGTTGGGAACTGCTGGGCCTTTTTTAGGAGAT---GACCATTTTTATAATGTTATTGTAACAGCTCATGCTTTTGTAATAATTTTTTTTCTAGTTATGCCTTTAATAATTGGAGGATTTGGAAACTGAATGGTTCCTTTACTAATTGGAGCTCCTGATATAAGTTTTCCTCGAATAAATAATATAAGGTTTTGATTACTTCCACCATCTTTTATTTTATTGTTGTGTTCAACTTTAATGGAAGGTGGTGCCGGAACAGGATGGACAGTTTACCCTCCTTTATCTGGTCCAATAGGACATGGTGGAACATCNNTTGATTTAGTAATTTTTTCTTTACACTTAGCTGGAGCTTCTTCTCTTCTTGGAGCAATTAATTTTATTACCACYATTTTTAATATGCGTTCACCTGCTATAACAATAGAACGTTTTAGGTTATTCGTCTGGGCTGTTTTGGTAACAGCTTTTCTTTTGCCTCTTTCTCTCCCTGTTCTGGCAGGGGCTATTACTATACTTTTGACAGATCGAAATTTTAATACAAGCTTTTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllidia elegans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Phyllidia elegans

Phyllidia elegans is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Phyllidiidae.[1]

Contents

Distribution

This species has been found in Indonesia, Malaysia, Thailand, the Andaman Sea, Myanmar, the Red Sea, the Mariana Islands, north Sulawesi, Vanuatu and Papua New Guinea.

Description

This animal can be distinguished by a pale-colored foot having a single median longitudinal black line on the sole, a light pink dorsal tubercles commonly tipped in yellow, and black lines on the lateral margins of the sole.[2]

References

  1. ^ Bouchet P. & Rocroi J.-P. (Ed.); Frýda J., Hausdorf B., Ponder W., Valdes A. & Warén A. 2005. Classification and nomenclator of gastropod families. Malacologia: International Journal of Malacology, 47(1-2). ConchBooks: Hackenheim, Germany. ISBN 3-925919-72-4. ISSN 0076-2997. 397 pp. http://www.vliz.be/Vmdcdata/imis2/ref.php?refid=78278
  2. ^ "Phyllidia elegans". Rfbolland.com. 1987-07-08. http://rfbolland.com/okislugs/phyleleg.html. Retrieved 2010-07-30.

Further reading

  • Brunckhorst, D.J. 1993. The Systematics and Phylogeny of Phyllidiid Nudibranchs (Doridoidea). Australian Museum, Sydney, Australia.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!