Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda aurantiomaculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGACTCCTAGGAACAGGGCTTAGCTTATTAATTCGATTTGAGTTAGGAACAGCGGGTGCTTTTCTTGGTGAT---GACCATTTTTATAACGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATGGTAATACCATTAATAATTGGAGGTTTTGGAAACTGAATGGTACCATTACTAATTGGAGCACCAGACATAAGATTTCCCCGTATAAATAACATAAGTTTCTGGTTACTCCCACCATCTTTTATTCTCTTACTATGTTCAACTTTAATAGAAGGAGGGGCTGGAACAGGATGAACTGTCTATCCACCATTGTCTGGACCAGTTGCTCATGGAGGTACCTCTGTAGATTTAGCTATTTTTTCTTTACACCTAGCAGGAGCTTCCTCACTACTTGGTGCAATTAATTTTATTACTACAATTTTCAATATGCGGTCCTCAGCTATATCTATAGAACGAGTGAGGTTGTTTGTCTGATCAGTATTAGTTACAGCCTTCCTACTTCTTCTTTCTCTCCCAGTTCTTGCAGGAGCAATCACTATACTATTAACTGATCGAAATTTTAATACTAGATTTTTTGATCCAGCAGGAGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda aurantiomaculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Museum Victoria
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda aurantiomaculata

Halgerda aurantiomaculata is a species of sea slug, a dorid nudibranch, shell-less marine gastropod mollusks in the family Discodorididae.[1]

References

  1. ^ Bouchet P. & Rocroi J.-P. (Ed.); Frýda J., Hausdorf B., Ponder W., Valdes A. & Warén A. 2005. Classification and nomenclator of gastropod families. Malacologia: International Journal of Malacology, 47(1-2). ConchBooks: Hackenheim, Germany. ISBN 3-925919-72-4. ISSN 0076-2997. 397 pp. http://www.vliz.be/Vmdcdata/imis2/ref.php?refid=78278
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!