Overview

Brief Summary

Introduction

This species is most easily separated from other members of the genus by the arrangement of photophores on the tentacles and the structure of the hectocotylus. It also appears to have shorter arms, relative to the mantle length, than in the other species.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.

  2. Tentacle-photophores
    1. Four large, ellipsoidal photophores (three are double photophores).
      1. Most distal member near base of carpal cluster (i.e., distance between this photophore and distal, spherical photophore much less than distance between distal two ellipsoidal photophores).
    2. Two smaller, spherical photophores, one at base of tentacular stalk and one at base of club.
    3. Spherical to ovoid superficial photophore (smallest of all) near base of tentacle and whose presence is variable.
    4. Figure. Diagramatic illustration of the tentacular photophores of P. addolux. Drawing by R. Young.

  3. Hectocotylus (right arm IV) with:
    1. 10 proximal hooks.
    2. Each proximal hook small with primary cusp bearing smooth inner edge and short secondary cusp.
    3. Flap short, almost semicircular.
    4. 6-7 hooks opposite flap.
    5. 6-15 suckers at tip.


    6. Figure. Hectocotylus of P. addolux. Top - Oral view, holotype, 30 mm ML, off Southern California. Drawing from Young, 1972. Middle - Oral view, 25 mm ML, Hawaiian waters. Photograph by R. Young. Bottom - Side view of arm tip showing suckers, 25 mm ML, Hawaiian waters. Photograph by R. Young.

Comments

Compare the following structures with other species of Pyroteuthis:

Arm and tentacle armature is shown here. Characters of species value associated with these structures are not presently recognized except on the hectocotylus.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Vertical distribution

Off Hawaii, P. addolux is generally found at 450-500 m deep during the day and 150-200 m at night (Young, 1978). It shows a clear pattern of vertical migration although a few large squid taken in three tows during the same cruise failed to migrate at night.

Figure. Vertical distribution of P. addolux from Hawaiian waters based on an opening-closing trawl. Yellow dots - Day captures. Blue dots - Night captures. Vertical lines indicate vertical-fishing range of the tow and the symbol represents the modal fishing depth of the trawl. In some cases, the vertical lines are covered by the symbols. Chart redrawn from Young, 1978.

Geographical distribution

P. addolux was first described from off southern California (Young, 1972). It is also known from Hawaiian waters. This map shows the general localities (white circles) where P. addolux has been captured. Areas where pyroteuthids, other than members of this species, have been captured are represented by yellow crosses. (records listed here).

Geographical variation

The second photophore from the base of the tentacle (photophore number 2) is less common in squid from Hawaiian waters than in squid from Californian waters. Otherwise, geographical variation in taxonomic characteristics is unknown.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

mesopelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 31 - 2075
  Temperature range (°C): 2.243 - 25.407
  Nitrate (umol/L): 0.011 - 38.940
  Salinity (PPS): 34.050 - 35.045
  Oxygen (ml/l): 2.397 - 5.686
  Phosphate (umol/l): 0.154 - 2.810
  Silicate (umol/l): 1.411 - 133.928

Graphical representation

Depth range (m): 31 - 2075

Temperature range (°C): 2.243 - 25.407

Nitrate (umol/L): 0.011 - 38.940

Salinity (PPS): 34.050 - 35.045

Oxygen (ml/l): 2.397 - 5.686

Phosphate (umol/l): 0.154 - 2.810

Silicate (umol/l): 1.411 - 133.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life history

Figure. Ventral view of P. addolux, 2.9 mm ML. Drawing modified from Young, et al., 1992.

Paralarvae of this species are identified by:

  1. A series of chromatophores on the distal portion of each tentacle (see arrow in drawing). Unfortunately these are easily lost due to damage during capture.
  2. Small branchial photophores (smaller than the anal organs).
  3. Large ocular photophores.
  4. Few chromatophores on mantle.

Compare with paralarvae of Pterygioteuthis microlampas and Pterygioteuthis giardi.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyroteuthis addolux

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATACTTCATCTTTGGTATTTGAGCTGGTTTGCTTGGAACTTCATTAAGACTTATAATTCGTACAGAATTAGGTCAACCAGGTTCACTTTTAAATGAC---GATCAACTTTACAATGTGGTTGTAACTGCTCACGGTTTTATTATAATTTTCTTTTTAGTTATACCTATTATAATTGGAGGATTCGGAAACTGGTTAGTGCCTTTGATGTTAGGTGCACCTGATATAGCCTTCCCTCGAATAAATAATATAAGATTCTGATTATTACCTCCCTCTTTAACCCTACTATTAGCCTCATCCGCTGTTGAGAGAGGAGCTGGTACTGGTTGAACTGTTTATCCTCCTTTATCTAGCAATCTTTCTCATGCTGGTCCTTCAGTAGATTTAGCTATTTTTTCTCTTCACTTAGCCGGGATTTCTTCTATTCTGGGAGCTATTAATTTCATTACAACAATTCTTAACATGCGATGAGAAGGTTTACAAATGGAGCGACTCCCACTTTTTGCCTGATCCGTATTTATCACTGCTATTTTGTTATTACTTTCCCTACCTGTTTTAGCAGGAGCTATTACAATACTTCTAACCGACCGAAACTTTAATACAACGTTTTTTGACCCTAGAGGAGGAGGTGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pyroteuthis addolux

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pyroteuthis addolux

Pyroteuthis addolux is a species of squid in the family Pyroteuthidae. It is distinguished from other members of the genus Pyroteuthis by the shape of photophores on the tentacles and the shape of the hectocotylus. The hectocotylus is located on arm IV, containing 10 proximity hooks, and six to 15 suckers at the tip. P. addolux ranges from south of the Hawaiian Islands, to the subantarctic boundary. They exhibit minor geographical variance, as southern specimens are slightly smaller than their northern counterparts. P. addolux is the only member of the genus to occur in the North Pacific, but additional members of the family Pyroteuthidae have also been found.[1] The species has been observed using bioluminescence to reduce its silhouette in dim surrounding light.

References

  1. ^ Richard Brodeur and Orio Yamamura. 2005. MICRONEKTON OF THE NORTH PACIFIC, North Pacific Marine Science Organisation (PICES): pg21.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!