Overview

Distribution

Southeastern Indian and Southwestern Pacific: Western Australia to Tasmania and southern New South Wales, Australia

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marine intertidal: rocky shores; mid littoral

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nerita atramentosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 120 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGTATGATCTGGTTTAGTTGGAACGGCTCTTAGACTTTTAATTCGGGCTGAACTTGGGCAGCCTGGAGCCCTTTTGGGTGAT---GATCAGCTTTACAATGTAATTGTTACTGCTCATGCGTTTGTAATAATTTTCTTTTTAGTAATGCCTATGATGATTGGGGGATTCGGTAATTGATTAGTTCCCTTAATGCTAGGGGCTCCTGATATGGCTTTTCCCCGGTTGAATAATATAAGTTTTTGATTGCTTCCCCCTTCTTTAACTTTGTTACTTGCTTCTTCTGCTGTAGAAAGTGGTGTCGGGACGGGTTGAACAGTATATCCTCCTTTGTCTGGGAATTTAGCCCATGCAGGGGGATCTGTGGATCTAGCTATTTTTTCTTTACACTTAGCAGGTGTTTCTTCTATTTTAGGTGCTGTAAATTTTATTACTACAATCATTAACATGCGGTGACAGGGAATGCAGTTCGAGCGATTGCCTCTTTTTGTGTGATCAGTGAAGATTACTGCAATTCTTCTTTTACTTTCTTTACCTGTGCTTGCTGGTGCAATTACTATGTTGCTAACTGATCGTAACTTTAATACATCTTTCTTTGACCCCGCAGGAGGTGGAGATCCTATTTTGTATCAGCATTTATTTTGATTTTTTGGTCATCCAGAGGTATATATTTTGATTTTACCTGGGTTTGGGATGATTTCTCATATTGTAAGTCACTACGCTTGTAAGAAAGAGACTTTTGGTACACTAGGAATGATTTACGCTATACTATCTATTGGTATTTTAGGATTTATTGTGTGGGCTCACCACATGTTTACAGTAGGAATAGACGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nerita atramentosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 119
Specimens with Barcodes: 119
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nerita atramentosa

Nerita atramentosa, common name the black nerite, is a medium-sized sea snail, a marine gastropod mollusc in the family Neritidae, the nerites.

There has been some confusion over the taxonomy of the Nerita genus in the Pacific region, however Nerita atramentosa and Nerita melanotragus are now recognised as separate species[1] (the two have often been considered to be the same species).

Ecology[edit]

Distribution[edit]

This nerite is endemic to the southern coastlands of Australia, including South Australia, southern Western Australia and Victoria. N. atramentosa occurs to the west of Wilsons Promontory in western Victoria, South Australia and southern Western Australia. The closely related species Nerita melanotragus occurs in eastern Victoria and New South Wales.[2]

Habitat[edit]

This species is commonly found on intertidal rocks, particularly in the mid to upper intertidal zone. It prefers to attach to sloped or vertical rock surfaces, or hang from the underside of rocks. This may be a method of thermoregulation, as if N. atramentosa is on a horizontal surface, it will absorb the maximum solar radiation. By contrast, if it is on a greater angle to the sun, it absorbs less energy (and thus heat).[3] N. atramentosa exhibits trail following behaviour. The species feeds by scraping epilithic algae using their radula. Nerites are preyed upon by reef crabs (Ozius truncatus).

References[edit]

  • Caddy-Retalic, S., Benkendorff, K. & Fairweather, P. (2011) Visualizing hotspots: Applying thermal imaging to monitor internal temperatures in

intertidal gastropods. Molluscan Research, 31(2) pp. 106–113.

  • Chilton, N. B & Bull, C. M. (1984) Influence of predation by a crab on the distribution of the size-groups of three intertidal gastropods in South Australia. Marine Biology, 83(2) pp. 163–169.
  • Spencer, H.G., Waters, J.M. & Eichhorst, T.E. (2007) Taxonomy and nomenclature of black nerites (Gastropoda: Neritimorpha: Nerita) from the South Pacific. Invertebrate Systematics, 21 pp. 229–237.
  • Waters, J.M., King, T.M., O'Loughlin, P.M. & Spencer, H.G. (2005) Phylogeographic disjunction in an abundant high-dispersal littoral gastropod. Molecular Ecology, 14 pp. 2789–2802.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!