Overview

Distribution

Range Description

Nerita articulata has a wide distribution in southeast Asia. In India it has been recorded from West Bengal (South 24 Paraganas (Matla River, Sunderban, Port Canning, Sajnakhali, Namkhana, Arbesy block (Sunderban), Gosaba, Chhota), Bhitarkanika, Muriaganga, and the Andaman Islands). It is also recorded from southern Thailand (Phang-Nga Province), Viet Nam, Singapore, Australia and Malaysia (Subba Rao 1989). It is also known from New Guinea and Indonesia (K. Richter, pers. comm., 2010).

It is likely to be present in Bangladesh, other east-coast Indian states, Myanmar, and other regional countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Burma through central region, including Indonesia to the Philippines, southern China to northeastern Australia

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is seen on rocky shores especially those near mangroves. The study by Tan and Clements (2008) found this snail on mangrove tree trunks and roots, monsoon canal walls, muddy banks, and rocky areas in or near mangroves. It is also common in nipa-palm swamps.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marine intertidal: marine to brackish waters; mangroves and muddy shores; upper littoral

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nerita balteata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGTGTGATCTGGTTTAGTCGGGACTGCTTTGAGACTTTTGATTCGAGCTGAGCTTGGCCAGCCAGGGGCTCTTTTGGGTGAT---GACCAGTTGTATAATGTAATTGTTACTGCTCATGCGTTTGTGATAATTTTCTTTTTGGTGATGCCTATGATGATTGGGGGATTTGGTAATTGATTAGTTCCTTTGATGCTAGGTGCTCCTGATATGGCGTTTCCTCGGTTGAACAATATGAGTTTTTGGCTGCTTCCACCTTCGTTAACTTTATTGCTTGCTTCTTCTGCTGTTGAAAGCGGAGTGGGAACGGGTTGAACGGTTTATCCTCCTTTATCCGGGAATCTAGCTCATGCAGGAGGCTCTGTGGATTTGGCTATTTTTTCGTTACATTTAGCTGGTGTATCTTCTATTTTAGGTGCTGTAAATTTTATTACTACAATTATTAATATGCGGTGGCAAGGGATGCAATTTGAGCGATTGCCTCTTTTTGTTTGATCAGTGAAGATTACTGCTATTCTTTTGTTGTTGTCTTTACCTGTTCTTGCTGGTGCAATTACTATGTTGTTAACTGATCGAAATTTCAATACGTCTTTTTTTGACCCTGCTGGAGGTGGGGATCCTATTTTGTACCAACATTTGTTTTGATTTTTTGGGCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATGATTTCTCACATTGTGAGCCATTATGCTTGTAAGAAAGAGACGTTTGGTACTTTAGGGATGATTTACGCTATGTTGTCCATTGGTATTTTGGGATTTATTGTGTGGGCTCACCATATGTTTACAGTGGGAATGGATGTTGATACACGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nerita balteata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Madhyastha, A.

Reviewer/s
Daniel, B.A., Molur, S. & Allen, D.

Contributor/s

Justification
Nerita articulata is widely distributed across south and southeast Asia, is known to be present in Australia, and is almost certainly present in other countries between the known locations in suitable habitat. There are some threats for this in some of its range countries, primarily the loss of mangrove due to clearance for aquaculture etc., however it does not seem to affect the population trend of the species hence it has been assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population estimates for this species in the eastern Himalayan region. In the other regions, there are quite crude reports on the population fluctuation attributed to natural factors (Tan and Clements 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Tan and Clements (2008) reports that this species affected by human activities such as reclamation and pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Surveys on distribution and research on the biology, population trends of this species are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nerita balteata

Nerita balteata is a species of sea snail, a marine gastropod mollusk in the family Neritidae. [1]

Contents

Description [edit]

The length of the shell is 11.5-33.8 mm.[2]

Distribution [edit]

Peninsular Malaysia[2]

Habitat [edit]

Mangrove forests.[3]

This species can be used as bioindicator of heavy metals in its environment, because it accumulates cadmium, nickel and lead in its shell and copper, zinc and iron in its soft tissues.[2]

References [edit]

  1. ^ a b Bouchet, P. (2010). Nerita balteata Reeve, 1855. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=549379 on 2012-02-09
  2. ^ a b c Yap, C. K.; Cheng, W. H. (2009). "Heavy metal concentrations in Nerita lineata: The potential as a biomonitor for heavy metal bioavailability and contamination in the tropical intertidal area". Marine Biodiversity Records 2. doi:10.1017/S1755267209000505. 
  3. ^ (Chinese) Chen, G.; Ye, Y.; Lu, C.; Li, R.; Weng, J.; Xu, Y. (2006). "Distribution of Littoraia melanostoma Gray (Littorinidae) and Nerita lineata Gmelin (Neritadae) in rehabilitated mangroves". Ying yong sheng tai xue bao = the journal of applied ecology / Zhongguo sheng tai xue xue hui, Zhongguo ke xue yuan Shenyang ying yong sheng tai yan jiu suo zhu ban 17 (9): 1721–1725. PMID 17147188. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!