Overview

Distribution

Southwestern Pacific: Tasmania, Australia to southern Queensland, Australia to northern New Zealand

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Marine intertidal: rocky shores; mid littoral

Creative Commons Attribution 3.0 (CC BY 3.0)

Frey, Melissa A.

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nerita melanotragus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGTATGATCTGGTTTAGTTGGAACGGCTCTT---AGACTTTTAATTCGGGCTGAACTTGGGCAGCCTGGAGCCCTTTTGGGTGAT---GATCAGCTTTATAATGTAATTGTTACTGCTCATGCGTTTGTAATAATTTTCTTTTTAGTAATGCCTATGATGATTGGGGGATTCGGTAATTGATTAGTTCCTTTAATG---TTAGGGGCTCCTGATATGGCTTTTCCCCGGTTGAATAATATAAGTTTTTGATTGCTTCCTCCTTCTTTAACCTTGTTACTTGCTTCTTCTGCTGTAGAAAGTGGTGTCGGGACGGGTTGAACAGTATATCCTCCTTTGTCTGGGAATTTAGCCCATGCAGGGGGATCTGTGGATCTA---GCTATTTTTTCTTTACACTTGGCAGGTGTTTCTTCTATTTTAGGTGCTGTAAATTTTATTACTACAATCATTAACATGCGATGACAGGGAATGCAGTTCGAGCGATTGCCTCTTTTTGTGTGATCAGTGAAGATTACTGCAATTCTTCTTCTACTTTCTTTACCTGTGCTTGCTGGT---GCAATCACTATGTTGCTAACTGATCGTAATTTCAATACATCTTTCTTTGATCCCGCAGGAGGTGGAGATCCTATTTTGTATCAGCATTTATTTTGATTTTTTGGTCATCCGGAGGTATATATTTTGATTTTACCTGGGTTTGGGATGATTTCTCATATTGTAAGTCACTACGCTTGTAAGAAA---GAGACTTTTGGTACACTAGGAATGATTTACGCTATACTATCTATTGGTATTTTAGGATTTATTGTGTGGGCTCACCACATGTTTACAGTAGGAATAGACGTAGATACACGAGCATATTTTACAGCGGCAACAATGATTATTGCTGTGCCTACAGGTATTAAGGTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nerita melanotragus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nerita melanotragus

Nerita melanotragus, common name black nerite, is a medium-sized sea snail, a marine gastropod mollusc in the family Neritidae, the nerites.

There has been some confusion over the taxonomy of the Nerita genus in the Pacific region, however Nerita atramentosa and Nerita melanotragus are now recognised as separate species (the two have often been considered to be the same species).[1]

Distribution[edit]

This nerite is endemic to the southern Pacific, including the south-eastern coast of Australia (Queensland, New South Wales, Victoria, Lord Howe Island, Norfolk Island, northern New Zealand and the Kermadec Islands.[2]

Habitat[edit]

This species is commonly found on intertidal rocks, particularly in the mid to upper intertidal zone. It prefers to attach to sloped or vertical rock surfaces, or hang from the underside of rocks. This may be a method of thermoregulation, because if N. atramentosa is on a horizontal surface, it would absorb the maximum solar radiation, whereas on sloped or vertical surfaces it absorbs less energy (and thus heat).

A shell of Nerita melanotragus, underside view

Shell description[edit]

The shell is of moderate size, very solid, globose-oval, and smooth except for weak shallowly incised spiral lines. The external shell colour is black, but the aperture is white, except for a narrow black border. Once shells get over about 26mm they start to wear down and typically have knotched sides and a white wear on the right hand side of the shell.

The operculum is granular, pinkish-lilac, with two spiral bands of black.

The shell height is up to 30 mm, and width 32 mm.

Genetics[edit]

An almost complete sequence of the mitochondrial DNA of this species was analyzed by Castro & Colgan (2010).[3]

References[edit]

  1. ^ Grove, S. (2007). Vicariance, dispersal, and the strange case of the Tasmanian Black Nerites. The Tasmanian Naturalist 129.[1]
  2. ^ Spencer, H. G.; Waters, J. M.; Eichhorst, T. E. (2007). "Taxonomy and nomenclature of black nerites (Gastropoda�:�Neritimorpha�:�Nerita) from the South Pacific". Invertebrate Systematics 21 (3): 229. doi:10.1071/IS06038.  edit.
  3. ^ Castro, L. R.; Colgan, D. J. (2010). "The phylogenetic position of Neritimorpha based on the mitochondrial genome of Nerita melanotragus (Mollusca: Gastropoda)". Molecular Phylogenetics and Evolution 57 (2): 918–923. doi:10.1016/j.ympev.2010.08.030. PMID 20817109.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!