Overview

Comprehensive Description

Summary

"Lambis truncata, commonly called the Truncate Spider Conch, and seen in the Indian Ocean is the largest and heaviest of spider shells."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Angle coronated or tuberculigerous on spire, unarmed on the last whorl; labium with the callus diffused; labrum with its margin erect, with six moderate digitations, and with the antisinual lobe a little undulated. Younger shells creamy white; columella and lip usually mauve brown when older."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: upto 40cm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

The largest and heaviest of spider shells, up to 40 cm. Similar to L. lambis but with a more squarish outline. Younger shells creamy white; columella and lip usually mauve brown when older. Habitat: on rubble and coarse sand in shallow water. Distribution: Indian Ocean. Regional names: Kis. Visimba, Vikocho. (Richmond, 1997).
  • Walls, J.G. (1980). Conchs, tibias and harps. A survey of the molluscan families Strombidae and Harpidae. T.F.H. Publications Ltd, Hong Kong.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

SubSpecies Varieties Races

"Subspecies Lambis truncata sebae (Kiener, 1843) - flat apex. Subspecies Lambis truncata truncata (Humphrey, 1786) - apex is more pointed."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic

Lips smooth. Body whorl unarmed at angle.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Similar to L. lambis but with a more squarish outline.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

General Habitat

Marine: on rubble and coarse sand in shallow coral reef areas.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lambis truncata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTCGGTATGTGATCTGGGTTAGTGGGAACTGCCCTAAGTCTTTTGATTCGAGCTGAACTTGGTCAACCAGGGGCTCTATTAGGAGAT---GATCAATTATACAATGTGATTGTTACAGCTCATGCCTTTGTTATAATTTTTTTCTTAGTTATGCCAATGATAATTGGAGGTTTTGGGAATTGACTAGTTCCTCTGATGCTAGGAGCTCCTGATATGGCTTTTCCACGCTTAAATAACATGAGATTCTGATTGCTTCCTCCTGCCTTGCTTTTACTTCTTTCATCAGCTGCTGTTGAGAGAGGGGTTGGTACAGGATGAACAGTATATCCACCTTTAGCCGGAAATCTCGCTCATGCTGGTGGGTCAGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGTGTTTCCTCTATTTTAGGAGCAGTTAATTTTATTACTACAATTATCAATATACGATGACGAGGGATGCAATTTGAACGTCTTCCTCTTTCTGTATGATCTGTGAAAATTACCGCTGTCCTCTTACTTCTTTCTTTACCTGTGTTAGCAGGAGCCATCACAATACTTCTAACGGATCGGAATTTTAATACAGCATTTTTTGATCCTGCTGGTGGTGGAGATCCTATTTTGTATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lambis truncata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Legislation

Listed in CITES: No. Listed in Wildlife (Protection) Act: Yes. Schedule: 1 Appendix: Part IV(B) Mollusca
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

Industrially used in lime production. Also sold as decorative items.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lambis truncata

Lambis truncata, common name the giant spider conch, is a species of sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.[1]

Contents

Subspecies

A shell of Lambis truncata truncata
A shell of Lambis truncata sebae

Subspecies of Lambis truncata include:

Lambis truncata truncata has a flat apex, while the apex of Lambis truncata sebae is more pointed.

Description

A colored drawing of Lambis truncata from Kiener, 1843, depicting both the shell and soft parts

Lambis truncata is the largest and heaviest of spider shells, up to 40 cm.[1] Lambis truncata is similar to Lambis lambis but with a more squarish outline.[1] Younger shells are creamy white; columella and lip usually mauve brown when older.[1]

Distribution

Distribution of Lambis truncata include Indian Ocean along :[1] Aldabra, Chagos, Madagascar, Mauritius, Tanzania; the Bay of Bengal and in the Pacific Ocean along the Philippines.

Ecology

Lambis truncata lives on rubble and coarse sand in shallow water.[1]

References

This article incorporates CC-BY-SA-3.0 text from the reference.[1]

  1. ^ a b c d e f g h i j Lambis truncata (Humphrey, 1786). WoRMS (2009). Lambis truncata (Humphrey, 1786). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=211091 on 27 June 2010.
  • Dautzenberg, Ph. (1929). Mollusques testacés marins de Madagascar. Faune des Colonies Francaises, Tome III
  • Spry, J.F. (1961). The sea shells of Dar es Salaam: Gastropods. Tanganyika Notes and Records 56
  • Walls, J.G. (1980). Conchs, tibias and harps. A survey of the molluscan families Strombidae and Harpidae. T.F.H. Publications Ltd, Hong Kong
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!