Overview

Distribution

Aldabra, Comores, Kenya, Madagascar, Mascarene Basin, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Conspicuous shell, up to 20cm, with coarse transverse ridges, large tubercles, and a heavy lip with seven more or less straight fingers of varying length. Exterior colour variable, white-cream with brown or bluish patches, sometimes with thin brown periostracum. Interior rich pink, orange or purple. Habitat: sheltered shallow waters. Distribution: Indo-Pacific. Regional names: Kis. Nyangale, Madole, Vikocho; Port. Aranha-de-sete-dedos. (Richmond, 1997).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 42 samples.

Environmental ranges
  Depth range (m): 1 - 20
  Temperature range (°C): 26.803 - 28.409
  Nitrate (umol/L): 0.067 - 0.617
  Salinity (PPS): 33.721 - 34.975
  Oxygen (ml/l): 4.336 - 4.666
  Phosphate (umol/l): 0.067 - 0.238
  Silicate (umol/l): 1.005 - 2.754

Graphical representation

Depth range (m): 1 - 20

Temperature range (°C): 26.803 - 28.409

Nitrate (umol/L): 0.067 - 0.617

Salinity (PPS): 33.721 - 34.975

Oxygen (ml/l): 4.336 - 4.666

Phosphate (umol/l): 0.067 - 0.238

Silicate (umol/l): 1.005 - 2.754
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lambis lambis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTCGGTATGTGATCAGGGTTAGTTGGGACTGCCCTAAGTCTCTTGATTCGAGCTGAACTTGGGCANCCAGGAGCTTTATTAGGGGAC---GACCAGCTATACAATGTGATTGTTACAGCTCATGCCTTTGTTATAATTTTTTTCTTAGTTATGCCAATAATGATTGGAGGCTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTTCCGCGCTTGAATAACATAAGATTCTGATTGCTTCCTCCTGCTCTACTTTTACTCCTTTCATCGGCTGCTGTCGAAAGAGGAGTTGGTACAGGATGAACAGTGTACCCGCCTTTAGCTGGGAATCTGGCCCATGCAGGTGGATCGGTTGACTTGGCTATTTTTTCCCTGCACTTAGCTGGTGTTTCTTCTATCCTAGGAGCAGTTAATTTTATCACTACAATTATTAATATACGATGGCGAGGAATACAATTTGAGCGTCTTCCTTTATTTGTATGATCTGTAAAAATTACTGCTGTTTTATTACTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACAATGCTTCTAACGGATCGAAATTTTAATACAGCGGTTTTTGATCCTGCTGGTGGTGGGGATCCTATCTTGTATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lambis lambis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum Victoria
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lambis lambis

Lambis lambis, common name the spider conch, is a species of large sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs. [2]

A shell of the spider conch, Lambis lambis, anterior end to the right

Contents

Shell description

Sexual dimorphism in the shell of Lambis lambis. Female on the left, male on the right. Arrows indicate the differences in morphology.

The maximum shell length for this species is up to 29 cm, and average length stands for 18 cm.[1] Lambis lambis has a very large, robust and heavy shell. One of its most striking characteristics is its flared outer lip, ornamented by six hollow marginal digitations. These digitations present subtle differences in shape between genders in this species, as the three anteriormost digitations are short and posteriorly bent in male individuals, and longer and dorsally recurved in females.[1] The color of the shell is highly variable, being white or cream externally and often presenting brown, purplish or bluish black patches. The interior is glazed and may be pink, orange or purple.[1][2]

Distribution

This species is widespread in the Indo-West Pacific, including Aldabra, Kenya, Madagascar, Mauritius, Mozambique, the Persian Gulf and the Red Sea, Seychelles, Tanzania, Micronesia, eastern Melanesia, Taiwan, southern Japan and northern Australia.[1][2]

Ecology

Habitat

This sea snail lives in mangrove areas, as well as reef flats and coral-rubble bottoms in shallow water from low tide levels to depths of 5m. It is usually found in association with red algae.[1]

Feeding habits

Lambis lambis is known to be herbivorous, feeding on fine red algae.[1]

References

  1. ^ a b c d e f g Poutiers, J. M. (1998). "Gastropods". In Carpenter, K. E. & Niem, V. H.. The living marine resources of the Western Central Pacific Volume 1. Seaweeds, corals, bivalves and gastropods. FAO Species Identification Guide for Fishery Purposes. Rome: FAO. pp. 467. ISBN 92-5-104051-6. ftp://ftp.fao.org/docrep/fao/009/w7191e/w7191e33.pdf.
  2. ^ a b c d Lambis lambis (Linnaeus, 1758). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=211096 on 2011-04-23
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!