Overview

Brief Summary

Mantis religiosa is a mantis species native to temperate areas of Europe, Asia and northern Africa, but has spread around the world and is now well established across the United States and into Canada. Outside of Europe it is known as the European mantis; in Europe, it is known simply as the preying mantis. It was introduced to the eastern US in 1899. In 1977 it officially became the state insect of Connecticut. The European mantis is 5-7.5 cm long, usually a shade of green with brown, usually well camouflaged in its surroundings, and also difficult to see because of its usually motionless stance. There are several other similarly large mantis species also commonly found in the United States: the Mediterranean mantis (Isis oragoria), the Chinese mantis (Tenodera aridigolia, and the native Carolina mantis (Stagmomantis carolina). The European mantis can be distinguished from these by a distinctive black bulls-eye pattern on its coxae (most proximal segment) of the fore leg.

Although a carnivore and an impressive predator, this mantis is completely harmless to humans and a beneficial species in that it eats many harmful insects, including the gypsy moth caterpillar, many aphids, flies, mites, grasshoppers and, when an individual comes upon another mantis, will show cannibalistic behavior. Thus, European mantises are solitary insects, coming together to mate only once a year. Females are known to eat the males after mating.



Females lay about 100 eggs in a white hardened foam ootheca (egg case) which they cement to a tree branch or leaf. The juveniles, miniature versions of adults, hatch in early spring, and are wind dispersed, or serve as nourishment for their siblings.

(Bartelt 2011; Ct.gov 2002; WSU 2011; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantis religiosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGTATTTTAATTCGAACAGAATTAGGTCAACCAGGTTCATTAATTGGAGAT---GATCAAATCTACAATGTTATTGTTACTGCTCACGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATGATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATA---CTTGGAGCACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCAATTCTATTATTACTAATTAGTAGAACAGTTGAAAGAGGAGCTGGGACAGGATGAACTGTTTATCCCCCTTTATCAGCAAGAATTGCTCATGCAGGACCCGCTGTAGATTTA---ACAATTTTTTCTCTTCACTTAGCAGGTATATCTAGTATTATAGGAGCAGTTAATTTTATTACAACTATAATTAATATAAAACCTATTTATATAAATCAAACTCAAGTTCCACTTTTTGTTTGATCTGTAGGTATTACAGCTCTACTTTTATTATTATCTCTACCAGTTCTTGCAGGA---GCAATTACTATACTTTTAACTGATCGAAATCTTAATACATCCTTCTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTCTAATTTTACCAGGATTTGGTATAATTTCTCATGTTATTTCACATGAAAGTGGTAAGAAA---GAAGCCTTTGGAAATTATGGTATAATTTGAGCTATATCAGCAATTGGTTTTTTAGGTTTTGTTGTTTGAGCTCATCACATATTTACAGTTGGAATAGATGTTGATACACGAGCTTATTTTACCGGAGCAACTATAATTATTGCAGTACCAACTGGAATTAAAATTTTTAGTTGACTT---GCAACAATATATGGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mantis religiosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European mantis

Mantis religiosa, referred to as the European mantis outside of Europe and known simply as the praying mantis in Europe and elsewhere, is one of the most well-known and widespread species of the order Mantodea.

Overview[edit]

Mantis religiosa, female with indicative marking (black spot) on fore coxa

Originating in southern Europe, the European mantis was introduced to North America in 1899 on a shipment of nursery plants. Now they are found all over the north-eastern United States and Canada to the Pacific Northwest. The European mantis is usually 5–7.5 cm (2–3 inches) in length, and has shades of bright green to tan. It can be distinguished easily by a black-ringed spot beneath the fore coxae. It is one of several different insects for which a name used within Europe to refer to only a single insect species (in this case, "praying mantis") has become adopted throughout the globe to refer to the larger group of insects to which that one species belongs (e.g., compare "hornet" to European hornet, or "wasp" to common wasp).

Despite being an introduced species, it is the official state insect of Connecticut.[1]

Range[edit]

Found in Europe, Africa, Asia and North America (introduced).

Subspecies[edit]

[4] [5]

Additional Images[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!