Overview

Distribution

Belize, Caribbean Sea, Colombia, Costa Rica, Gulf of Mexico, Hispaniola, Jamaica, Lesser Antilles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Littorina interrupta Philippi, 1847
Catalog Number: USNM 603130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): C. Adams
Locality: Jamaica, Caribbean Sea, North Atlantic Ocean
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinolittorina interrupta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATGTGGTCTGGCTTAGTGGGTACTGCTTTAAGCCTTCTTATTCGAGCTGAGTTAGGACAGCCTGGTGCCCTTTTAGGGGAT---GACCAGTTGTATAATGTTATTGTAACAGCTCATGCTTTTGTAATAATTTTCTTTTTAGTTATACCTATGATGATTGGTGGGTTTGGTAATTGGCTTGTTCCTTTGATGTTAGGAGCACCTGATATAGCATTTCCTCGCTTGAATAATATGAGTTTCTGGTTACTTCCCCCAGCTTTATTGTTATTGCTTTCTTCGGCTGCGGTTGAAAGTGGTGTAGGAACTGGATGGACTGTATATCCTCCATTGGCAGGGAATTTAGCTCATGCTGGAGGGTCGGTAGATTTAGCAATTTTCTCTCTGCATTTGGCTGGTGTTTCGTCTATTTTAGGGGCTGTAAATTTTATTACAACTATTATTAATATACGATGACGAGGAATACAATTCGAGCGTTTACCTCTTTTTGTTTGGTCAGTTAAAATTACGGCCATTTTGTTGCTTTTATCTCTTCCTGTTTTGGCGGGAGCAATTACAATGTTGCTTACTGATCGAAATTTTAATACTGCCTTCTTCGATCCTGCTGGTGGAGGGGATCCAATTTTATACCAGCATTTGTTTTGATTTTTTGGGCATCCGGAAGTTTATATTTTAATTCTTCCTGGGTTTGGAATAATTTCTCATATTGTTAGTCATTATTCTGCTAAAAAAGAAACTTTTGGGACCTTAGGAATAATTTATGCTATGTTAGCTATTGGTGTTTTAGGGTTTATTGTTTGGGCTCATCATATATTTACGGTGGGAATAGACGTAGATACTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echinolittorina interrupta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Echinolittorina interrupta

Echinolittorina interrupta is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Distribution

Description

The maximum recorded shell length is 24 mm.[2]

Habitat

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 0 m.[2]

References

  1. ^ Echinolittorina interrupta (Philippi, 1847). Reid, David G. (2010). Echinolittorina interrupta (Philippi, 1847). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=419559 on 6 June 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!