Overview
Distribution
Belize, Caribbean Sea, Colombia, Costa Rica, Gulf of Mexico, Hispaniola, Jamaica, Lesser Antilles
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Miloslavich P, Díaz JM, Klein E, Alvarado JJ, Díaz C, et al. (2010) Marine Biodiversity in the Caribbean: Regional Estimates and Distribution Patterns. PLoS ONE 5(8): e11916. doi:10.1371/journal.pone.0011916
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145466
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Type Information
Paratype for Littorina interrupta Philippi, 1847
Catalog Number: USNM 603130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): C. Adams
Locality: Jamaica, Caribbean Sea, North Atlantic Ocean
Catalog Number: USNM 603130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): C. Adams
Locality: Jamaica, Caribbean Sea, North Atlantic Ocean
- Paratype:
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 8 specimens in 1 taxon.
Environmental ranges
Depth range (m): 0 - 0
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 0 - 0
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Echinolittorina interrupta
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATTTTATTTGGTATGTGGTCTGGCTTAGTGGGTACTGCTTTAAGCCTTCTTATTCGAGCTGAGTTAGGACAGCCTGGTGCCCTTTTAGGGGAT---GACCAGTTGTATAATGTTATTGTAACAGCTCATGCTTTTGTAATAATTTTCTTTTTAGTTATACCTATGATGATTGGTGGGTTTGGTAATTGGCTTGTTCCTTTGATGTTAGGAGCACCTGATATAGCATTTCCTCGCTTGAATAATATGAGTTTCTGGTTACTTCCCCCAGCTTTATTGTTATTGCTTTCTTCGGCTGCGGTTGAAAGTGGTGTAGGAACTGGATGGACTGTATATCCTCCATTGGCAGGGAATTTAGCTCATGCTGGAGGGTCGGTAGATTTAGCAATTTTCTCTCTGCATTTGGCTGGTGTTTCGTCTATTTTAGGGGCTGTAAATTTTATTACAACTATTATTAATATACGATGACGAGGAATACAATTCGAGCGTTTACCTCTTTTTGTTTGGTCAGTTAAAATTACGGCCATTTTGTTGCTTTTATCTCTTCCTGTTTTGGCGGGAGCAATTACAATGTTGCTTACTGATCGAAATTTTAATACTGCCTTCTTCGATCCTGCTGGTGGAGGGGATCCAATTTTATACCAGCATTTGTTTTGATTTTTTGGGCATCCGGAAGTTTATATTTTAATTCTTCCTGGGTTTGGAATAATTTCTCATATTGTTAGTCATTATTCTGCTAAAAAAGAAACTTTTGGGACCTTAGGAATAATTTATGCTATGTTAGCTATTGGTGTTTTAGGGTTTATTGTTTGGGCTCATCATATATTTACGGTGGGAATAGACGTAGATACTCGGG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Echinolittorina interrupta
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Echinolittorina interrupta
Echinolittorina interrupta is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]
Contents |
Distribution
 | This section is empty. You can help by adding to it. (June 2010) |
Description
The maximum recorded shell length is 24 mm.[2]
Habitat
Minimum recorded depth is 0 m.[2] Maximum recorded depth is 0 m.[2]
References
- ^ Echinolittorina interrupta (Philippi, 1847). Reid, David G. (2010). Echinolittorina interrupta (Philippi, 1847). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=419559 on 6 June 2010.
- ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
