Overview

Distribution

European waters (ERMS scope), Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Turbo fabalis Turton, 1825
Catalog Number: USNM 185758
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Bean & Turton
Locality: Scarborough, England, United Kingdom, North Atlantic Ocean
Microhabitat: on the rocks
  • Syntype: Turton, W. 1825. Zoological Journal. 2: 366.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0 - 2
  Temperature range (°C): 11.768 - 12.348
  Nitrate (umol/L): 4.729 - 7.121
  Salinity (PPS): 35.184 - 35.363
  Oxygen (ml/l): 6.069 - 6.151
  Phosphate (umol/l): 0.336 - 0.439
  Silicate (umol/l): 2.448 - 3.285

Graphical representation

Depth range (m): 0 - 2

Temperature range (°C): 11.768 - 12.348

Nitrate (umol/L): 4.729 - 7.121

Salinity (PPS): 35.184 - 35.363

Oxygen (ml/l): 6.069 - 6.151

Phosphate (umol/l): 0.336 - 0.439

Silicate (umol/l): 2.448 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Littorina fabalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATGATCTGGGCTTGTTGGTACTGCCTTAAGCCTTCTTATTCGAGCTGAACTGGGCCAGCCTGGTGCTCTCCTAGGAGAC---GACCAGCTGTACAACGTTATTGTTACAGCTCACGCTTTTGTAATAATTTTTTTCCTAGTTATGCCTATAATAATTGGTGGATTCGGGAATTGACTTGTGCCTCTAATGTTAGGAGCACCCGATATAGCATTCCCACGCTTAAATAATATAAGCTTTTGACTCCTCCCACCTGCTTTGCTACTGTTATTATCTTCAGCCGCAGTAGAAAGTGGTGTAGGAACAGGCTGAACTGTATACCCCCCTTTGTCCGGAAATTTGGCCCATGCTGGGGGCTCTGTAGACTTAGCTATTTTCTCTCTCCATTTAGCTGGTGTTTCATCTATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATACAATTTGAACGATTGCCTCTTTTTGTTTGATCAGTAAAAATTACAGCCATTCTTCTACTTCTATCCCTTCCTGTTTTAGCAGGAGCTATTACAATATTGCTAACCGATCGAAATTTTAATACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Littorina fabalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Littorina fabalis

Littorina fabalis is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

The maximum recorded shell length is 14.9 mm.[2]

Habitat

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 0 m.[2]

References

  1. ^ a b Littorina fabalis (Turton, 1825). WoRMS (2010). Littorina fabalis (Turton, 1825). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140261 on 6 June 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!