Overview
Distribution
European waters (ERMS scope), Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Type Information
Syntype for Turbo fabalis Turton, 1825
Catalog Number: USNM 185758
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Bean & Turton
Locality: Scarborough, England, United Kingdom, North Atlantic Ocean
Microhabitat: on the rocks
Catalog Number: USNM 185758
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Bean & Turton
Locality: Scarborough, England, United Kingdom, North Atlantic Ocean
Microhabitat: on the rocks
- Syntype: Turton, W. 1825. Zoological Journal. 2: 366.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.
Environmental ranges
Depth range (m): 0 - 2
Temperature range (°C): 11.768 - 12.348
Nitrate (umol/L): 4.729 - 7.121
Salinity (PPS): 35.184 - 35.363
Oxygen (ml/l): 6.069 - 6.151
Phosphate (umol/l): 0.336 - 0.439
Silicate (umol/l): 2.448 - 3.285
Graphical representation
Depth range (m): 0 - 2
Temperature range (°C): 11.768 - 12.348
Nitrate (umol/L): 4.729 - 7.121
Salinity (PPS): 35.184 - 35.363
Oxygen (ml/l): 6.069 - 6.151
Phosphate (umol/l): 0.336 - 0.439
Silicate (umol/l): 2.448 - 3.285
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 9 samples.
Environmental ranges
Depth range (m): 0 - 2
Temperature range (°C): 11.768 - 12.348
Nitrate (umol/L): 4.729 - 7.121
Salinity (PPS): 35.184 - 35.363
Oxygen (ml/l): 6.069 - 6.151
Phosphate (umol/l): 0.336 - 0.439
Silicate (umol/l): 2.448 - 3.285
Graphical representation
Depth range (m): 0 - 2
Temperature range (°C): 11.768 - 12.348
Nitrate (umol/L): 4.729 - 7.121
Salinity (PPS): 35.184 - 35.363
Oxygen (ml/l): 6.069 - 6.151
Phosphate (umol/l): 0.336 - 0.439
Silicate (umol/l): 2.448 - 3.285
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Littorina fabalis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATATGATCTGGGCTTGTTGGTACTGCCTTAAGCCTTCTTATTCGAGCTGAACTGGGCCAGCCTGGTGCTCTCCTAGGAGAC---GACCAGCTGTACAACGTTATTGTTACAGCTCACGCTTTTGTAATAATTTTTTTCCTAGTTATGCCTATAATAATTGGTGGATTCGGGAATTGACTTGTGCCTCTAATGTTAGGAGCACCCGATATAGCATTCCCACGCTTAAATAATATAAGCTTTTGACTCCTCCCACCTGCTTTGCTACTGTTATTATCTTCAGCCGCAGTAGAAAGTGGTGTAGGAACAGGCTGAACTGTATACCCCCCTTTGTCCGGAAATTTGGCCCATGCTGGGGGCTCTGTAGACTTAGCTATTTTCTCTCTCCATTTAGCTGGTGTTTCATCTATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATACAATTTGAACGATTGCCTCTTTTTGTTTGATCAGTAAAAATTACAGCCATTCTTCTACTTCTATCCCTTCCTGTTTTAGCAGGAGCTATTACAATATTGCTAACCGATCGAAATTTTAATACT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Littorina fabalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Littorina fabalis
Littorina fabalis is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]
Contents |
Description
The maximum recorded shell length is 14.9 mm.[2]
Habitat
Minimum recorded depth is 0 m.[2] Maximum recorded depth is 0 m.[2]
References
- ^ a b Littorina fabalis (Turton, 1825). WoRMS (2010). Littorina fabalis (Turton, 1825). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140261 on 6 June 2010.
- ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
