Overview

Distribution

Atlantic, Indian Ocean, South Africa
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Litorina knysnaensis Philippi, 1847
Catalog Number: USNM 714057
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Knysna River Mouth, Western Cape, South Africa, Indian Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Afrolittorina knysnaensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTCGGCATGTGATCTGGACTTGTGGGTACTGCCCTAAGCCTTCTTATTCGAGCTGAGCTAGGCCAACCAGGCGCTTTACTGGGAGAC---GATCAATTATATAATGTAATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTCTAGTTATACCTATAATAATTGGTGGATTTGGAAATTGACTTGTACCTTTAATATTAGGGGCCCCTGATATGGCATTCCCTCGTTTAAATAATATAAGTTTTTGACTCCTCCCTCCCGCTCTGCTTCTTTTATTATCTTCAGCTGCCGTTGAAAGTGGTGTTGGAACAGGATGAACTGTATATCCTCCATTGTCAGGTAATTTAGCCCACGCTGGCGGATCAGTAGATTTAGCAATTTTTTCTCTTCACTTAGCAGGTGTTTCTTCTATTTTAGGAGCTGTAAACTTTATTACGACTATTATTAATATACGTTGACGAGGAATACAATTTGAACGTTTACCCCTTTTCGTTTGATCAGTAAAAATTACAGCTATTCTTCTCCTTCTATCTCTTCCTGTACTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTTAATACTGCCTTTTTTGACCCAGCTGGTGGTGGTGATCCTATCCTATATCAACATCTATTTTGATTTTTTGGACACCCGGAGGTATATATTTTAATTCTTCCTGGCTTTGGAATAATTTCCCATATTGTTAGCCATTATTCTGCTAAGAAAGAAACTTTCGGAACCTTAGGTATAATTTATGCGATACTTGCAATTGGTGTTTTAGGTTTTATTGTTTGAGCCCACCACATGTTTACAGTTGGTATAGATGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Afrolittorina knysnaensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Afrolittorina knysnaensis


Afrolittorina knysnaensis, common name the southern periwinkle, is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

The size of the shell varies between 9 mm and 15 mm. Its color varies from brown with a pattern of dots with a dark ring around its every whorl, to pure black. The smooth shell has a conical shape with a short spire. The aperture is subcircular and has a transparent, horny operculum.

Distribution

This marine species occurs off Namibia to Southern KwaZuluNatal; in the Indian Ocean off Réunion

References

  1. ^ a b Afrolittorina knysnaensis (Philippi, 1847) . Reid, David G. (2010). Afrolittorina knysnaensis (Philippi, 1847). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=446837 on 6 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!