Molecular Biology and Genetics

Molecular Biology

Barcode data: Afrolittorina knysnaensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTCGGCATGTGATCTGGACTTGTGGGTACTGCCCTAAGCCTTCTTATTCGAGCTGAGCTAGGCCAACCAGGCGCTTTACTGGGAGAC---GATCAATTATATAATGTAATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTCTAGTTATACCTATAATAATTGGTGGATTTGGAAATTGACTTGTACCTTTAATATTAGGGGCCCCTGATATGGCATTCCCTCGTTTAAATAATATAAGTTTTTGACTCCTCCCTCCCGCTCTGCTTCTTTTATTATCTTCAGCTGCCGTTGAAAGTGGTGTTGGAACAGGATGAACTGTATATCCTCCATTGTCAGGTAATTTAGCCCACGCTGGCGGATCAGTAGATTTAGCAATTTTTTCTCTTCACTTAGCAGGTGTTTCTTCTATTTTAGGAGCTGTAAACTTTATTACGACTATTATTAATATACGTTGACGAGGAATACAATTTGAACGTTTACCCCTTTTCGTTTGATCAGTAAAAATTACAGCTATTCTTCTCCTTCTATCTCTTCCTGTACTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTTAATACTGCCTTTTTTGACCCAGCTGGTGGTGGTGATCCTATCCTATATCAACATCTATTTTGATTTTTTGGACACCCGGAGGTATATATTTTAATTCTTCCTGGCTTTGGAATAATTTCCCATATTGTTAGCCATTATTCTGCTAAGAAAGAAACTTTCGGAACCTTAGGTATAATTTATGCGATACTTGCAATTGGTGTTTTAGGTTTTATTGTTTGAGCCCACCACATGTTTACAGTTGGTATAGATGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Afrolittorina knysnaensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Afrolittorina knysnaensis


Afrolittorina knysnaensis, common name the southern periwinkle, is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Description[edit]

The size of the shell varies between 9 mm and 15 mm. Its color varies from brown with a pattern of dots with a dark ring around its every whorl, to pure black. The smooth shell has a conical shape with a short spire. The aperture is subcircular and has a transparent, horny operculum.

Distribution[edit]

This marine species occurs off Namibia to Southern KwaZuluNatal; in the Indian Ocean off Réunion

References[edit]

  1. ^ a b Afrolittorina knysnaensis (Philippi, 1847) . Reid, David G. (2010). Afrolittorina knysnaensis (Philippi, 1847). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=446837 on 6 June 2010.
  • Paul Bartsch (1915), Report on the Turton Collection of South African Marine Mollusks, with Additional Notes on other South African Shells Contained in the United States National Museum; Smithsonian Institution, United States National Museum, bulletin 91.
  • Kilburn, R.N. & Rippey, E. (1982) Sea Shells of Southern Africa. Macmillan South Africa, Johannesburg, xi + 249 pp. page(s): 50
  • Steyn, D.G. & Lussi, M. (1998) Marine Shells of South Africa. An Illustrated Collector’s Guide to Beached Shells. Ekogilde Publishers, Hartebeespoort, South Africa, ii + 264 pp. page(s): 32
  • George M. Branch,C. l. Griffiths,M. L. Branch,L. E. Beckley, Two Oceans: A Guide to the Marine Life of Southern Africa
  • Reid, D.G. & Williams, S.T. (2004) The subfamily Littorininae (Gastropoda: Littorinidae) in the temperate Southern Hemisphere: the genera Nodilittorina, Austrolittorina and Afrolittorina. Records of the Australian Museum 56: 75122
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!