Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 6.5
  Temperature range (°C): 28.324 - 28.324
  Nitrate (umol/L): 0.895 - 0.895
  Salinity (PPS): 33.845 - 33.845
  Oxygen (ml/l): 4.477 - 4.477
  Phosphate (umol/l): 0.073 - 0.073
  Silicate (umol/l): 1.464 - 1.464

Graphical representation

Depth range (m): 1 - 6.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinolittorina millegrana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTTGGTATGTGATCTGGCTTAGTTGGTACAGCTTTAAGACTTCTTATTCGAGCTGAATTAGGCCAGCCCGGAGCTCTTTTAGGTGAC---GATCAGCTGTACAATGTTATTGTGACAGCTCACGCTTTCGTTATAATTTTTTTCTTAGTTATACCAATGATAATTGGTGGTTTTGGAAATTGGCTTGTTCCTTTGATATTAGGGGCGCCTGATATGGCTTTCCCTCGATTGAATAACATAAGTTTTTGATTACTTCCTCCGGCTTTACTTTTATTGCTTTCTTCTGCTGCTGTTGAAAGTGGTGTAGGAACTGGGTGAACTGTATATCCCCCTTTATCTGGTAATCTGGCTCATGCTGGAGGTTCTGTGGATCTAGCGATCTTCTCACTCCATTTGGCTGGTGTGTCTTCTATTTTGGGAGCCGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATGCAATTTGAGCGATTACCTCTTTTCGTGTGGTCGGTAAAAATTACAGCTGTTTTGTTGCTTTTATCTCTTCCTGTTTTAGCTGGGGCTATTACAATGCTATTAACTGATCGAAATTTTAATACTGCATTTTTTGATCCTGCAGGGGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGGCATCCTGAGGTTTATATTCTAATTCTTCCTGGATTTGGAATAATTTCTCATATTGTTAGTCACTATTCAGCTAAAAAAGAGACTTTTGGAACTTTAGGTATAATTTATGCTATACTTGCCATTGGTGTTTTAGGATTTATTGTCTGAGCTCATCATATGTTTACGGTGGGAATGGATGTAGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echinolittorina millegrana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Echinolittorina millegrana

Echinolittorina millegrana is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

Distribution

References

  1. ^ a b Echinolittorina millegrana (Philippi, 1848). Reid, David G. (2009). Echinolittorina millegrana (Philippi, 1848). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=437373 on 6 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!