Overview

Comprehensive Description

Tetramorium pacificum Mayr HNS

(Fig. 44)

Tetramorium pacificum Mayr HNS , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum HNS see Bolton, 1977: 102.]

Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).

Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.

T. pacificum HNS ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum HNS is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.

  • Bolton, B. (1979): The ant tribe Tetramoriini (Hymenoptera: Formicidae). The genus Tetramorium Mayr in the Malagasy region and in the New World. Bulletin of the British Museum (Natural History) Entomology 38, 129-181: 168-168, URL:http://atbi.biosci.ohio-state.edu/HymOnline/reference-full.html?id=6435
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tetramorium pacificum Mayr HNS 1870b

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tetramorium pacificum is a medium-sized dark colored ant that is most often encountered on vegetation. This species has a monomorphic worker caste with 12-segmented antennae, three-segmented antennal club, antennal scrobes, short antennal scapes that do not surpass the posterior margin of the head, a gradually sloped mesosoma, and strong propodeal spines. Like all myrmicines, T. pacificum has two waist segments and a gaster armed with a stinger. Tetramorium pacificum has established populations outside of its native range, but it is not believed to cause significant damage to ecological or agricultural systems. The species is most often encountered on vegetation in disturbed or edge forest habitat.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomic History

Taxonomic history

Imai, Kubota, et al. 1985: 47 (k.).
Senior synonym of Tetramorium subscabrum: Bolton, 1977 PDF: 102.
See also: T. scabrum Mayr, 1879 sp.rev., T. manobo (Calilung, 2000) (Hymenoptera: Formicidae) – three good species. Myrmecologische Nachrichten 8:181-191. [2006-09]">Schlick-Steiner, Steiner & Zettel, 2006 PDF: 182; Formicidae) in the Malagasy region—introduction, definition of species groups, and revision of the T. bicarinatum, T. obesum, T. sericeiventre and T. tosii species groups. Zootaxa 3039:1-72. [2011-09-22]">Hita Garcia & Fisher, 2011 PDF: 24.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Islands of Leyte, Luzon, Mindanao, Negros, Romblon
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Diagnosis of worker among Antkey species. Worker caste monomorphic. Head shape roughly subrectangular. Antenna 12-segmented. Antennal club 3-segmented. Antennal scapes not conspicuously short; easily extended beyond eye level; do not extend beyond posterior margin of head. Antennal scrobe present. Antennal insertion surrounded by a raised sharp-edged ridge. Posterolateral corners of head unarmed, without spines. Eyes medium to large (greater than 5 facets); distinctly less than half head length. Frontal lobes do not obscure face outline between mandible and eye; relatively far apart so that the posteromedian portion of the clypeus, where it projects between the frontal lobes, is much broader than one of the lobes. Anterior margin of clypeus notched. Mandibles triangular. Cephalic dorsum with short lateral rugae intersecting longer longitudinal rugae. Mesosoma with erect hairs. Pronotal spines absent. Propodeum armed with long robust spines. Slope of mesosoma gradual. Waist 2-segmented. Petiole with a wave-shaped node; pedunculate; lacking large subpetiolar process postpetiole attached to lower surface of gaster. Postpetiole not swollen; in dorsal view not distinctly broader than long or distinctly wider than petiole. Erect hairs moderately distributed, long and thin. Color uniformly dark brown to black.


Tetramorium pacificum is distinguished from its fellow congeners that are introduced in the United States by the following combination of characters: (1) petiolar node wave-shaped (versus evenly rounded for T. lanuginosum and T. tonganum; versus square-shaped for T. bicarinatum, T. nr. caespitum, T. caldarium, T. simillimum and T. tsushimae); (2) erect hairs long and thin (versus short and thick for T. caldarium and T. simillimum); (3) cephalic dorsum with short lateral rugae intersecting longer longitudinal rugae (versus primarily subparallel, non-intersecting longitudinal rugae for T. nr. caespitum and T. tsushimae); and (4) propodeal spines long and robust (versus small triangular teeth in T. nr. caespitum, T. tsushimae, T. caldarium and T. simillimum); (5) color uniformly brownish yellow to orange (versus dark brown to black for T. pacificum). The bicolored red and black appearance separate it from all but some specimens of T. caldarium and T. simillimum. The species looks most similar to P. insolens, but is distinguished by its darker brown to black (versus yellowish brown to orange) color.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomic Treatment

Forel, A., 1912:
 [[worker]]. Pilam.
 

Emery, C., 1893:
 - Kandy, Colombo.
  Le pedicule de l'abdomen est beaucoup moins comprime que chez le type des iles Tonga (exemplaire provenant du Museum Godeffroy) et plus fortement rugueux; la base de l'abdomen est plus fortement striee: toutefois ces caracteres ne sont pas aussi prononces que chez T. scabrum Mayr (1) auquel cette forme fait passage. La couleur est d'un brun fonce ou noire; avec les mandibules, les trochanters, les genoux et les tarses d'un brun clair.
 J'ai recu de M. Andre une [[ worker ]] de la Nouvelle-Caledonie qui ressemble beaucoup a celles de Ceylan.
 

Ward, P. S., 2005:
 I [introduced species]
 

Bolton, B., 1979:
 (Fig. 44)
 Tetramorium pacificum Mayr , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum see Bolton, 1977: 102.]
 Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).
 Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.
 T. pacificum ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

I [introduced species]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(Fig. 44)

 

Tetramorium pacificum Mayr , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum see Bolton, 1977: 102.]

 

Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).

 

Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.

 

T. pacificum ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.

License not applicable

Bolton, B.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Tetramorium insolens

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tetramorium pacificum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATNANGTATTTTTTATTTGCTATTTGAGCCNGAATAATCGGATCTTCAATNANAATAATTATTCGACTAGAATTAGGATCATGTAACTCAATTATCAATAATGATCAAGTATATAATACTTTAATCACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGTGGATTTGGAAATTTTTTAATCCCACTAATACTCGGAACTCCAGATATAGCCTACCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCATCTATTATATTATTATTATTTAGAAGATTTATTAATATAGGGGTAGGAACAGGCTGAACTATTTATCCCCCACTAGCTTCAAATATATTTCATAGGGGGCCTTCAGTAGATATATCAATTTTCTCTCTTCATATTGCCGGTATATCGTCCATTTTAGGGGCAATTAATTTTATCTCCACTATTTTAAATATACACCACAAAAAATTATCCTTAGATAAGATCCCACTATTAGTATGATCTATTCTAATCACAGCAATCCTTTTATTACTATCATTACCAGTACTGGCAGGAGCAATTACTATACTTTTAACAGACCGAAACCTAAACACNTCATTTTTTGACCCATCNGGGGGGGGAGACCCTATCCTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium pacificum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!