Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Lugworms eat the sand on the tidal flats. They digest anything edible in the sand. The filtered sand is ejected after going through their intestines. In order to get enough to eat, the animal has to process a lot of sand. It eats 3.5 liters of sand per year. Lugworms live in a U-shaped tunnel. They eat sand from one end of the tunnel, forming a funnel on the surface. Whatever is indigestible is pressed out at the other end of the tunnel. This is where the typical spaghetti piles of sand come from.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This lugworm lives in burrows in the sediment at depths of 20-40cm (3). It feeds on organic matter in the sediment by drawing water into the burrow and filtering particles from the current (2). The sexes are separate, and spawning typically occurs in late autumn and winter (3). Males release sperm, which rests in puddles on the sediment surface before being dispersed by the tide (2). Females release eggs into the burrow, where they are fertilised by sperm that is drawn into the burrow with the respiratory current (2). Initially, the larvae develop inside the burrow, they then crawl or swim to the sediment surface where they are dispersed by currents (2). The larvae settle on areas of sand or shingle and live inside mucus tubes attached to the sediment; after a few months these tubes detach, and the young worms drift in the water for a time before burrowing into the sediment (2). Sexual maturity is reached after around 2 years, and spawning occurs once a year. The average life-span of this worm is thought to be around 6 years (2). Although they are relatively safe within their burrows, this species is vulnerable to predation by flatfishes and birds, who crop the tail region of the worm as it deposits casts; the worm usually survives, although the growth rate may subsequently decrease (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The presence of this lugworm can be detected by the characteristic signs of one of its U or J-shaped burrows; depressions are formed at the head-end, and a cast of coiled defecated sediment is present at the tail-end (3). This segmented worm has a cylindrical body, which has two distinct regions; the thoracic region bears bristles (known as 'chaetae'), and the last 13 segments also have bushy gills (3). The abdominal region (the tail end), which is thinner than the thoracic region, lacks gills and bristles. The colour of this worm varies greatly; it may be pink, red, brown, black or green (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Additional information

Disambiguation of the common English name. "Lugworm" may also be used incorrectly as the general English name representing any locally harvested for sale bristleworm in Korea, China, Japan, etc. Consequently, nereidid baitworms such as Perinereis aibuhitensis (q.v.) imported into California strangely are known there as lugworms. Also Asian trade statistics referring to lugworms are not relevant to arenicolid usage elsewhere.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Arenicola marina is the familiar lugworm, much prized as bait by anglers. This sedentary polychaete has a firm, cylindrical body divided into a thoracic and an abdominal region. The head is small, with no appendages or eyes although a rough proboscis may be visible. The thoracic region consists of 19 parapodia bearing segments (with chaetae), of which the last 13 bear bushy gills. The abdominal region is narrower and consists of many segments lacking chaetae and gills. Apart from the head, each segment is divided by 5 rings (annuli). Adults reach between 120 -200mm in length and vary in colour from pink to dark pink, red, green, dark brown or black. Digs a U or J-shaped burrow (20-40cm deep) with characteristic depressions at the head end (the 'blow hole') and a cast of defaecated sediment at the tail end. Feeds on detritus and micro-organisms in ingested sediment. The cast is large and often the colour of clean sand. Tolerates salinities down to 12 psu. Preyed on by flatfish and wading birds, which may 'nip' off the tail as it deposits casts. May be confused with Arenicola defodiens (the black lug) which is generally darker (usually black), longer (up to 270mm), burrows deeper (usually 40-70cm), rarely forms a 'blow hole', produces a finer, neater cast, prefers more exposed coasts rather than estuaries and differs in the number of annuli between the first 4 pairs of chaetae bearing segments and in the shape of the gills.Arenicola defodiens sp. nov. has recently been distinguished from Arenicola marina on the basis of the morphology of the gills, the annulation pattern between the first 4 chaetigerous segments, size, burrow depth, cast type and shape, colour, absence of a feeding depression and genetic polymorphism (see Cadman & Nelson-Smith, 1993). These two species may represent the 'laminarian' and 'littoral' forms respectively referred to by earlier authors.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of St. Lawrence (unspecified region), southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), downstream part of middle St. Lawrence estuary, lower St. Lawrence estuary, lower North Shore, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Common around all coasts of Britain and Ireland. Elsewhere it is known from western Europe, Norway, Iceland, Siberia, Greenland and on the coasts of the western Atlantic (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

intertidal and infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2229 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): -2 - 70
  Temperature range (°C): -0.245 - 12.348
  Nitrate (umol/L): 0.927 - 8.636
  Salinity (PPS): 26.346 - 35.363
  Oxygen (ml/l): 6.069 - 7.462
  Phosphate (umol/l): 0.057 - 0.943
  Silicate (umol/l): 2.315 - 15.658

Graphical representation

Depth range (m): -2 - 70

Temperature range (°C): -0.245 - 12.348

Nitrate (umol/L): 0.927 - 8.636

Salinity (PPS): 26.346 - 35.363

Oxygen (ml/l): 6.069 - 7.462

Phosphate (umol/l): 0.057 - 0.943

Silicate (umol/l): 2.315 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found from high water neap tidal level to the middle or lower shore in sand and muddy sand, living in a characteristic U or J-shaped burrow. Often reaches high abundances in sheltered estuarine sediments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found on the middle and lower shore, in sand and muddy sand (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Arenicola marina (Arenicola marina lugworm) is prey of:
Pomatoschistus microps
Pleuronectes platessa
Platichthys flesus
Crangon crangon
Corynosoma strumosum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Arenicola marina (Arenicola marina lugworm) preys on:
POM

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arenicola marina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACAATATACTTCATTTTTGGGATTTGAGCCGGTCTCTTAGGAACCTCAATAAGACTTCTTATTCGAACCGAACTAGGCCAACCTGGCTCATTTTTAGGAAGTGACCAGCTTTATAACACTATCGTAACTGCTCACGCATTTTTAATAATTTTTTTCTTAGTAATACCAGTATTTATTGGCGGTTTCGGAAACTGATTAGTACCTCTTATATTAGGTGCACCAGATATAGCCTTCCCCCGTATAAATAATATAAGATTTTGACTTCTACCCCCCTCCTTAACTCTCCTTCTTGCCTCAGCAGCAGTAGAAAAAGGGGTAGGAACAGGATGAACAGTTTATCCTCCTTTAGCAAGAAACTTAGCCCATGCAGGCCCTTCAGTTGACCTGGCTATTTTTTCTCTACATATTGCAGGAGCATCCTCAATTTTGGGGGCTATTAATTTTATTACTACAGTAATCAACATACGATGAAAAGGCCTACAACTTGAACGAGTACCACTATTTGTATGATCTGTAAAAATTACAGCAATTCTTCTCCTTTTATCCCTTCCAGTATTAGCAGGCGCAATCACAATATTACTTACTGACCGAAACTTAAATACAGCATTCTTTGACCCTGCCGGAGGAGGAGATCCTGTTCTATATCAACACTTATTTTGATTCTTTGGGCACCCAGAAGTTTATATTTTAATTTTACCAGCATTTGGAACTATTTCACATATTGTAACACACTACGCTGGCAAACTTGAACCCTTTGGTACATTAGGAATAATCTATGCTATACTAGGAATTGGTATCCTAGGATTTATTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arenicola marina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Lugworms provide an important source of food for many species of wading shore birds including the oystercatcher (Haematopus ostralegus) and curlew (Numenius arquata). They are also collected commercially for use as bait in angling (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lugworm

The lugworm or sandworm, Arenicola marina, is a large marine worm of the phylum Annelida. Its coiled castings are a familiar sight on a beach at low tide but the animal itself is rarely seen except by those who, from curiosity or to use as fishing bait, dig the worm out of the sand.

When fully grown, the lugworm of the coasts of Europe is up to 9 inches long and 3/8 inch in diameter. Other species on the North American coast range from 3 to 12 inches. The body is like that of an earthworm: ringed or segmented. Its head end, which is blackish-red and bears no tentacles or bristles, passes into a fatter middle part which is red. This in turn passes into a thinner yellowish-red tail end. The middle part has bristles along its sides and also pairs of feathery gills. There is a well-developed system of blood vessels with red blood rich in the oxygen-carrying pigment, haemoglobin.[2]

Life in a burrow[edit]

A lugworm lives in a U-shaped burrow in sand. The U is made of an L-shaped gallery lined with mucus, from the toe of which a vertical unlined shaft runs up to the surface. This is a head shaft. At the surface the head shaft is marked by a small saucer-shaped depression. The tail shaft, 2-3 inches from it, is marked by a highly coiled cast of sand. The lugworm lies in this burrow with its head at the base of the head shaft, swallowing sand from time to time. This makes the column of sand drop slightly, so there is a periodic sinking of the sand in the saucer-shaped depression. When it first digs its burrow the lugworm softens the sand in its head shaft by pushing its head up into it with a piston action. After that the sand is kept loose by a current of water driven through the burrow from the hind end by the waves of contraction passing along the worm's body. It weighs 2-5 oz. Lugworms also have groups of hair on the outside of their bodies that act as external gills. These can rapidly increase its uptake of oxygen.

Lugworm cast
Lugworms are not typicaly visible, but the casts produced by their burrowing make distinctive patterns in damp sand


Burrowing babies[edit]

Once it burrows into the sand a lugworm seldom leaves it. It can stay there for weeks on end, sometimes changing its position slightly in the sand. But it may leave the burrow completely and re-enter the sand, making a fresh burrow for breeding but for 2 days in early October there is a genital crisis. This is when all the lugworms liberate their ova and sperms into the water above, and there the ova are fertilized. The ova are enclosed in tongue-shaped masses of jelly about 8 inches long, 3 inches wide and 1 inch thick. Each mass is anchored at one end. The larvae hatching from the eggs feed on the jelly and eventually break out when they have grown to a dozen segments and are beginning to look like their parents. They burrow into the sand, usually higher up the beach than the adults, and gradually move down the beach as they get older.

In popular culture[edit]

Cartoonist Piers Baker created a syndicated comic strip called Ollie and Quentin, with a buddy storyline about Ollie, a seagull and Quentin, a lugworm. The strip originated in the UK in 2002, with King Features Syndicate introducing it to international syndication in early 2008. Baker considers the strip "an homage to all the poor lugworms that he used as bait while sea fishing in his youth."

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!