Overview

Distribution

Theodoxus fluviatilis is considered holarctic, occurring in both the Nearctic and Palearctic biogeographic regions. However, they are more commonly seen in the Palearctic region, spreading far west to England, and east into southwestern Asia. Many patches within Europe are uninhabited, mainly the mountainous regions. This snail's ability to survive in freshwater allowed for migration throughout Eastern Europe, and later re-entry into the brackish waters of the Baltic Sea.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is the most widely distributed species of the Theodoxus genus. The freshwater subspecies T. fluviatilis fluviatilis is widespread, with a Western Palaearctic range, occurring principally in the lowlands of northern, central and eastern Europe and southern Sweden to 60 degrees north. It is widespread in suitable habitats across Europe from western Russia eastwards to the Iberian peninsula and from the Balkan peninsula in the south to southern Scandinavia in the north (Zettler et al. 2004). The range of this species occurs as far as Ireland to the west (Lucey et al. 1992), and as far as the Scottish Orkney islands to the north (Zettler et al. 2004). It also occurs in lowland areas of Anatolia (Yildirim 1999). It is now expanding towards the Black Sea Basin and the Carpathian Basin where this species is invasive. There are large areas across Europe in which this species is absent, in particular in mountainous areas (Bunje 2005). This species is absent in Norway and is only present in Finland on the Åland islands (Zettler et al. 2004). It has also become extinct in the Czech Republic (Farkac et al. 2005).

The subspecies T. fluviatilis littoralis is present in the North Sea in brackish waters of the Orkney islands and the Netherlands, and in low salinity waters of the Baltic Sea (Zettler et al. 2004). It also occurs in the Black Sea in waters with a salt content below 18% (Butenko 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widespread throughout Europe from the British Isles and Spain to the Caucasus and the Black Sea, and from the Baltic Sea to Italy.  Reported from Turkey (Bafra and Sinop on the southern coast of the Black Sea, Öktener, 2004), but these findings are probably the very similar Theodoxus  heldreichi (von Martens, 1879).     

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Eichhorst, Thomas

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Although difficult to distinguish between different species of Theodoxus, Theodoxus fluviatilis has a few main morphological features used for identification. These include size, color patterns of the periostracum, the operculum and the radula. The common river nerite has a soft-tissued body encased within a round, calcareous shell. This species is known to absorb the inner walls of the shell, thus allowing for a more spacious environment inside the shell. This absorption may allow more room for their food intake. The operculum, a hard, proteinaceous plate protecting the body when fully retracted within the shell, is light red with broad ribs. The margin of the operculum is red.

The species has an average mass of 50 mg, an average shell length of 9 mm, and an average shell width of 6 mm. The different specimens, marine and freshwater, show some morphological variances. Freshwater specimens tend to be larger and thicker than the marine forms. Freshwater specimens also have a yellowish-green color, while marine forms are mostly black. Since they are dioecious, the male and female sexes are separate. Both have reproductive organs. The male's penis is located on the right side of their body, near the base. The female reproductive organs are located inside the mantle cavity. Within the mantle cavity, females have two openings, one for fertilization and the other for discharging their eggs.

Range mass: .025 to .345 g.

Average mass: .050 g.

Average length: 9 mm.

Average wingspan: 6 mm.

Range basal metabolic rate: 1 to 8 cm3.O2/g/hr.

Average basal metabolic rate: 5 cm3.O2/g/hr.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Commonly known as the river nerite, Theodoxus fluviatilis was first discovered in saltwater, originating in the Black Sea. Currently this species is mainly found in freshwater streams and rivers. The river nerite is also found along coastal regions of the Black and Baltic Seas, and also lives in estuaries, regions where freshwater rivers meet saltwater seas. Within this habitat, it lives on hard benthic substrates, typically rocks and submerged wood, and in calcium-rich waters. Theodoxus fluviatilis also lives as deep as 60 meters below the surface, and is sometimes found no higher than a centimeter above the water surface.

Average elevation: .01 m.

Range depth: 0 to 60 m.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species can be found in rivers, larges lakes, estuarine section of rivers, brackish coastal waters and springs (within the Mediterranean part of the range). It requires a solid surface such as rocks, concrete, stones to be able to attach itself to. The species displays wide polymorphism in shell pattern and colour, making it difficult to identify (Anistratenko 2005).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 22
  Temperature range (°C): 8.600 - 8.600
  Nitrate (umol/L): 1.265 - 1.265
  Salinity (PPS): 7.618 - 7.618
  Oxygen (ml/l): 8.061 - 8.061
  Phosphate (umol/l): 0.326 - 0.326
  Silicate (umol/l): 11.134 - 11.134

Graphical representation

Depth range (m): 1 - 22
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marine to freshwater, under stones or wood in river systems of Europe, especially in running water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Eichhorst, Thomas

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

As Theodoxus fluviatilis is an herbivore and a detritivore, it mainly feeds on phytoplankton (mainly diatoms), but also feeds on detritus and a variety of algae. Its radula is specialized to grind even the hardest phytoplankton, making it easier to digest. Detritus is the organic material that comes from dead or decomposing plants or animals. While developing, the larva will feed within the egg capsule.

Plant Foods: algae; phytoplankton

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: herbivore (Algivore); detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Theodoxus fluviatilis plays an important role for the health and maintenance of large structuring macrophytes. They aid the growth of the perennial brown alga, Fucus vesiculosus. While other grazers inhibit the ability of Fucus to uptake nitrogen, T. fluviatilis does not, and thus aids in the growth of the algae. Not much is known about their symbiotic relationships with other animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because their hard calcareous shell completely covers their body, most predators avoid Theodoxus fluviatilis as a potential food source. Their eggshells are also calcified and hardened, thus protecting them when predators attack. However, a few known predators include the European perch, Perca flavescens, as well as two crayfishes, Orconectes limosus and Astacus astacus. These animals have adaptations that allow them to break through the snails' calcareous shell. Orconectes limosus, endemic to North America, is an invasive species in Europe.

Known Predators:

  • European perch, Perca flavescens
  • Spiny-cheek crayfish, Orconectes limosus
  • European crayfish, Astacus astacus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like many other gastropods, Theodoxus fluviatilis has a well-developed nervous system. Sense organs include eyes, statocysts, tactile organs, and chemoreceptors. Statocysts are fluid-filled cellular cysts used to sense direction of gravity, and thus sense equilibrium. Chemoreceptors are used to detect chemical stimuli. The snails also have a pair of eyes, each located at the end of their antennae that give them a visual sense perception of their habitat. Thus, they see their environment, sense movement, and also sense their state of balance.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Theodoxus fluviatilis develops in a similar manner as most other gastropods, however, the snail develops within the egg, so there is no larval form. The shell forms as the egg is developing. Initially, the mouth is anterior and the anus is posterior. However, after a process known as torsion, the positions of the body parts change.

Torsion involves two steps, each being a 90 degree rotation. The first rotation is caused by a contraction of the foot retractor muscle. It rotates the shell and visceral mass 90-degrees counterclockwise, leaving the anus on the right side of the body. The second rotation is caused by further development of differentiating tissues. This allows for the mantle cavity to develop near the anus and an additional 90-degree rotation, placing the anus directly above the head and mouth.

The positioning of the anus above the head would normally result in sanitary problems, with wastes washing directly over the gills. However, this is resolved by another process known as coiling. Coiling is not the same as torsion, however it can occur at the same time in development as torsion. Coiling of the shell and visceral mass allow for the loss of the gill, auricle, and kidney, all on the right side of the mantle cavity, and thus allow the snails to avoid sanitation problems. Since the water-flow through the mantle cavity is unidirectional, it flows into the left side and out of the right side, carrying with it wastes from the anus, which is near the right side. The single gill on the left side is then exposed only to clean water, avoiding any such sanitation problems. Once eggs hatch, they are considered miniature adults and take 18 months to fully mature into adult snails.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Theodoxus fluviatilis lives in nature for approximately two to three years. Longevity in an aquarium kept at room temperature has been recorded as two years.

Range lifespan

Status: wild:
3.5 (high) years.

Range lifespan

Status: captivity:
2 (high) years.

Typical lifespan

Status: wild:
2 to 3 years.

Average lifespan

Status: captivity:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Theodoxus fluviatilis reproduces between April and October. These snails have separate sexes and reproduce sexually. The male reproductive organ is located on the right side of its body. The female reproductive organs are within the mantle cavity. In the mantle cavity, there are two openings, one for fertilization and another for discharging the eggs. Fertilization is internal. The nerites are oviparous, females laying calcified eggs, normally on benthic surfaces or on their shell near the opening.

Mating System: monogamous

Theodoxus fluviatilis are dioecious and oviparous. They are semelparous, producing offspring all at once, after which the parent usually dies. During their mating season, anywhere from 50 to 200 eggs are laid. These eggs are collectively known as a capsule, and only one of them contains an embryo. Each egg is made of two spherical halves, which split when newborns hatch. The rest are used as a food source for the newborns. Embryos usually take about 100 days to fully develop. Since they are involved in a biennial life cycle, their eggs hatch some time in the fall as miniature adults and fully mature 18 months later.

Breeding interval: They breed once in their lifetime, and they usually die after.

Breeding season: They breed between the warmer months of April and October.

Range number of offspring: 50 to 200.

Average age at sexual or reproductive maturity (female): 18 months.

Average age at sexual or reproductive maturity (male): 18 months.

Key Reproductive Features: semelparous ; sexual ; fertilization (Internal ); oviparous

Not much is known on the parental investment of T. fluviatilis, but some were found with their eggs attached to their shell near the opening. This could be some form of protection of the eggs from possible predators or even by providing nutrients to their young. The young are precocial when they hatch.

Parental Investment: precocial ; pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Theodoxus fluviatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 45 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTTGGTGTTTGATCAGGGTTAGTTGGAACTGCTTTAAGTTTGTTAATTCGAGCGGAACTTGGGCAGCCTGGTGCTTTATTAGGGGAT---GACCAGCTTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTCTTGTGATGCCTATAATAATTGGAGGTTTTGGTAATTGATTGGTTCCATTAATGTTAGGAGCTCCTGATATGGCATTTCCTCGGTTAAATAACATGAGTTTTTGGCTTCTTCCTCCNTCACTTACTTTATTGTTGGCTTCATCTGCAGTGGAAAGTGGGGTTGGTACTGGCTGAACTGTATACCCTCCTTTATCTGGAAATTTAGCTCATGCGGGAGGTTCTGTTGATTTAGCTATTTTTTCTCTACATTTGGCTGGTGTATCTTCTATTTTAGGGGCTGTTAATTTCATTACTACAATTATTAATATGCGATGACAAGGGATGCAATTTGAGCGATTGCCTTTATTTGTCTGATCTGTAAAAATTACTGCAATTTTATTATTATTATCTTTACCTGTGCTTGCTGGAGCAATTACTATACTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGTGGTGGTGATCCAATTTTATATCAGCACTTGGTTTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Theodoxus fluviatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Theodoxus fluviatilis are considered extinct in the Czech Republic. They are also endangered in Switzerland and Latvia, and considered in jeopardy in other European countries including the Netherlands and Slovenia. They are also protected under law in Latvia.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Kebapçı, U. & Van Damme, D.

Reviewer/s
Bohm, M., Collen, B. & Seddon, M.

Contributor/s
Seddon, M., Killeen, I., Offord, S., Duncan, C., Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., De Silva, R., Milligan, HT, Herdson, R., Thorley, J., Collins, A., McMillan, K. & Richman, N.

Justification
This is a widespread species which is both very common in certain parts of its range and is relatively tolerant to pollution; it is continuing to spread in the Danube drainage. Therefore it is assessed as Least Concern.

This species has been assessed at the regional level:
EU27 regional assessment: Least Concern (This species is categorised as Least Concern in the 27 member states of the European Union)
European regional assessment: Least Concern
Mediterranean regional assessment : Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In some parts of its range this species is known to be very common (Zettler et al. 2004). The trends are unknown over the range, but some countries report a decline. In other parts of the region it is expanding, for example in the Danube in western Slovakia (Čejka et al. 2006). The species has a life span of 2-3 years and the eggs are laid from mid-April to October, with juveniles hatching after 30 - 60 days.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The principal threats to the species are pollution of its habitats through eutrophication or other chemical sources, alteration of water courses, changes to flow regimes, and over-frequent dredging, however these threats don't seem to create major declines in the species. Mouthon (1996) showed that T. fluviatilis was relatively insensitive to biodegradable pollution. In the Danube, where it is an invasive species, it is replacing the original Theodoxus spp., as it seems to tolerate the polluted waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation efforts known for this species.

In Red Lists of Latvia, Italy, UK, and the Republic of Ireland it is viewed as Least Concern. In The Netherlands it was considered to be Vulnerable. In Switzerland the species was considered to be highly threatened (CR equivalent), and in Czech Republic it is listed as Extinct (Farkac et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Theodoxus fluviatilis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known positive effects of Theodoxus fluviatilis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Theodoxus fluviatilis

Theodoxus fluviatilis, common name the river nerite, is a species of small freshwater and brackish water snail with a gill and an operculum, an aquatic gastropod mollusk in the family Neritidae, the nerites.[13]

This widely distributed neritid snail species occurs from Europe to Central Asia. It has a thick shell with a calcified operculum. The coloration pattern on the shell is very variable. Theodoxus fluviatilis lives in freshwater and in brackish water, in rivers and lakes on stones. It feeds mainly by grazing on biofilms and diatoms.

Some of the populations of this species are spreading, and these can reach densities up to thousands of snails per square meter. Females lay egg capsules, each of which contains a large number of eggs, but only one snail hatches from the capsule. The snails reach sexual maturity in a year, and the total lifespan is 2 or 3 years.

Taxonomy[edit]

Theodoxus fluviatilis was originally described under the name Nerita fluviatilis by Carl Linnaeus in 1758. Linnaeus' original text (the type description) in Latin was very short, and reads as follows:[3]

Which means in English: "Nerita fluviatilis, number 632: the shell is wrinkled, there are no teeth in the aperture. It inhabits rivers in Europe." Later, this species was moved to the genus Theodoxus Montfort, 1810. Theodoxus fluviatilis is in fact the type species of the genus Theodoxus.[5] Anistratenko and colleagues designated the lectotype for Theodoxus fluviatilis in 1999[14] (an English translation was published by Anistratenko in 2005).[5]

Subspecies[edit]

Several subspecies of Theodoxus fluviatilis were described and (inconsistently) recognized by various authors:

  • Theodoxus fluviatilis fluviatilis (Linnaeus, 1789)[2][15][16] – was described from freshwater[17]
  • Theodoxus fluviatilis fluviatilis f. fontinalis Brard, 1815,[15] which is sometimes considered as a synonym of Theodoxus fluviatilis[2]
  • Theodoxus fluviatilis littoralis (Linnaeus, 1789)[1][15] – This taxon was described from brackish water by Linneaus as a separate species, Nerita littoralis.[17] Study by Zettler (2008)[12] proved, that recognizing of this subspecies is unjustified.[12] Therefore it is regarded as a synonym of Theodoxus fluviatilis.[2] Although these forms (form fluviatilis and form littoralis) differ in morphology, ecology, reproductive strategy and in behaviour, they are probably ecomorphs only.[18]
  • Theodoxus fluviatilis sardous (Menke, 1830)[2]
  • Theodoxus fluviatilis subthermalis Issel, 1865[2] – or Theodoxus subthermalis (Bourguignat in Issel, 1865)[9]
  • Theodoxus fluviatilis thermalis (Dupuy, 1851)[2]
    Syntypes of Theodoxus fluviatilis thermalis at MHNT
  • Theodoxus fluviatilis transversetaeniatus A. J. Wagner, 1928[2]
  • Theodoxus fluviatilis dalmaticus Sow. – in Lake Ohrid[19]
  • Theodoxus fluviatilis euxinus (Clessin, 1885) has been considered to be a subspecies[16] – see Theodoxus euxinus (Clessin, 1886)[2]

Bunje (2005)[11] does not consider Theodoxus velox Anistratenko, 1999[8] to be a distinct species from Theodoxus fluviatilis.[11]

Cladogram[edit]

A cladogram shows the phylogenic relationships within the genus Theodoxus:[20]

Theodoxus




clade A: Theodoxus anatolicus, Theodoxus jordani, and Theodoxus macrii




clade C: Theodoxus danubialis and Theodoxus prevostianus



clade B: Theodoxus fluviatilis and Theodoxus euxinus





clade D: Theodoxus baeticus, Theodoxus valentina, Theodoxus meridionalis




clade F: Thedoxus peloponnesa




clade E: Theodoxus transversalis



This cladogram shows that the sister group to clade B is clade C. They split in 5–11.5 Ma, when Lake Pannon existed.[20] Theodoxus species living in brackish water include Theodoxus fluviatilis and Theodoxus jordani, but they are not closely related.[20]

Distribution[edit]

The exact type locality for this species is unknown, but it is probably the Main river in Southern Germany.[5][21] Glöer (2002)[15] considered the type locality sensu Linnaeus as "Habitat in fluviis, Upsaliae ad molendinam Ulvam & alibi", but this would suggest a brackish water environment.[12] The distribution of this species was considered to be European,[22] but in reality the species occurs in the western to central Palaearctic.[23] Its occurrence is scattered throughout Europe and in Western Asia[5] except for the Alps and the regions immediately north of the Alps.[10] This species does not live in Norway[10][17] or Siberia.[23] Theodoxus fluviatilis has the most widespread distribution of all of the species in the genus Theodoxus.[11] Indeed, it is one of the most widely distributed species in the entire family Neritidae.[24]

This species is threatened mainly by river engineering and water pollution in densely populated regions.[10] The species' population trend is overall stable, but is declining in some areas (Germany),[12] while in other areas it is expanding (for example in the Danube river).[1] In the Rhine river during the 1970s, Theodoxus fluviatilis came close to local extinction because of water pollution.[24] Subsequently, the water quality improved for more than two decades, leading to a recovery. Even so, the species became extinct in the Rhine for an unknown reason in the late 1990s.[24] Since 2006, Theodoxus fluviatilis recolonized the Rhine, probably via ship transport through the Main-Danube Canal.[24] An analysis based on cytochrome-c oxidase I (COI) gene has shown that the recolonization probably originated in the Danube.[24]

Western Europe[edit]

The species occurs widely in Western Europe, and it is also widespread in the north of Ireland,[25] living in 10% of Irish streams and rivers.[26] It lives in Great Britain,[25] including the isle of Orkney,[17] as well as in the Netherlands,[27] Belgium, Luxembourg, Liechtenstein, and Monaco.[1] It also is found in France[25] and Switzerland (critically endangered[10]) and in the south it occurs in Spain[1][17] and Portugal,[1] although the species is restricted to karst springs in Central Portugal.[28]

Central Europe[edit]

In central Europe, this species lives in Austria, where it is non-indigenous, in the Danube near Tulln, Lower Austria, since 2001.[29] In the Czech Republic, it is now extinct in Bohemia;[30][31] the only findings were in the Elbe river near Litoměřice in 1917,[31] and the most recent findings of empty shells took place in 1943.[31] Theodoxus fluviatilis also occurs in Poland,[17] in Slovakia where it is non-indigenous since 2002,[31][32] and in Hungary.[1] Zettler (2008)[12] provided a detailed bibliography of the distribution of T. fluviatilis in Germany. The indigenous distribution of T. fluviatilis included all of the large rivers: Rhine, Main, Moselle, Neckar, Weser, Elbe and Oder.[12] However, this species is now highly endangered in Germany[17] (Stark gefährdet).[33]

Northern Europe[edit]

In northern Europe this species is found in Denmark,[17] in Sweden as far north as 58° N.[10] It can also be found on the coasts of Finland,[34] in the Åland Islands, and is known to be found alive there since 1994.[17][35] No other Theodoxus species reaches the Baltic Sea. It has the northernmost distribution of the genus Theodoxus and it is also the northernmost species of all Neritidae.[20]

Eastern Europe[edit]

In Eastern Europe this snail occurs in Estonia,[17] Lithuania,[17] and Latvia,[17] as well as Belarus,[36] and in Russia from western Russia[17] to Caucasus.[34] Since 1997 it has been found in the Gulf of Odessa, Ukraine.[37] In Ukraine and in Crimea it is non-indigenous, and was first recorded in the area in 1955.[38] It also occurs in Moldova.[39]

Southern Europe[edit]

In Southern Europe, Theodoxus fluviatilis lives in Albania,[1] Bosnia and Herzegovina,[1] Romania,[1] Bulgaria,[1] Slovenia,[1] and Croatia.[40] In Macedonia and Albania it occurs in Lake Ohrid (which spans the border of the two countries) as the subspecies Theodoxus fluviatilis dalmaticus.[19][41] It is found on the mainland of Greece and also on Crete.[11][42] It is known to occur in the mainland of Italy[1] and also in Sardinia.[34] It occurs in Montenegro,[1][43] and in Serbia.[1][18]

Asia[edit]

In Asia this species is found in Turkey,[16] and in Iran it is found in Kerman Province, Gilan Province, Mazandaran Province, Fars Province, Hormozgan Province, Lorestan Province and Khorasan Province.[23] However, until 2012, all the records from Iran were listed as Theodoxus doriae.[23]

Africa[edit]

In Africa this species occurs in Algeria,[43] and possibly (or probably) in Morocco, where there are records which some authors consider to be reliable.[23] However, instead of one species, Theodoxus fluviatilis, Brown (1994) recognized three species in northwestern Africa: Theodoxus numidicus, Theodoxus maresi, Theodoxus meridionalis.[44]

Prehistoric biogeography[edit]

Shells of Theodoxus fluviatilis have been found in an Upper Paleolithic archaeological site in the cave Caldeirão, Pedreira (Tomar), Tomar Municipality, Portugal,[45] and also in a site from about 6000 years B.P. of Litorina age on the Åland Islands.[35] Shells from the Late Neolithic have been found in Divoká Šárka, Czech Republic.[46][47] Bunje (2005)[11] hypothetized that the ancestral range of Theodoxus fluviatilis was the Ponto-Pannonian region (southern Ukraine, Romania and Hungary).[11] Bunje suggested that the species first colonized northern Italy, Greece and Turkey; in the second phase it colonized Spain, France and Germany; and finally in the Holocene it colonized the British Isles, Sweden and the Baltic Sea.[11] Glöer (2002)[15] summarized the distribution of this species during the Pleistocene and Holocene epochs.

Description[edit]

Five views of a shell of Theodoxus fluviatilis.

The shell of Theodoxus fluviatilis is somewhat depressed (with an usually low spire), strongly calcified, and has 3–3.5 whorls (including the protoconch).[25][43][48] Larger specimens are usually eroded.[17][34] The width of an adult shell is usually 5–9 mm,[10] but can reach up to 11–13 mm.[10][31] The height of the shell is 4–6.5 mm,[10] or up to 7 mm.[31] These mean values vary among populations depending on the environment: the maximum width of the shell of brackish water populations is 9.3 mm.[17] Brackish water shells are somewhat shorter, reaching up to 5.8 mm,[17] and the maximum weight of the shell is 124 mg.[17] In freshwater populations, the maximum recorded shell width is 13.1 mm,[17] and maximum height is 9.3 mm.[17] The maximum weight of freshwater shells is 343 mg.[17]

The exterior of the shell is basically whitish or yellowish, with a net-like dark reddish or violet pattern. This pattern is very variable (depending on environmental factors), sometimes partly presenting bands, and even occasionally being evenly dark.[10] The shell is very variable in color and color patterns, showing great polymorphism.[5] Shell coloration and patterns are very plastic in all species of the genus Theodoxus and these qualities may be influenced by factors like ionic composition of water, type of substratum and nutrition of individuals in various habitats.[43] Zettler and colleagues (2004)[17] showed that in the outer coastal water of Baltic Sea, the nearly black and often corroded shell form of Theodoxus fluviatilis is predominant, whereas in the inner (sheltered) parts of coastal waters, yellowish-green forms prevail.[43] Glöer and Pešić (2015) observed that specimens from a darker stony substrate were black or dark brown.[43] Shells of specimens of Theodoxus fluviatilis from Northern Europe are ornamented with a pattern of white, drop-like spots on a dark or red background.[43] Specimens from South France and Spain are ornamented with a pattern of zigzag stripes, while specimens from the Balkans show all possible combinations of white drop-like spots and zigzag stripes.[43] Animals from lacustrine habitats show dark or light bands on the shell.[43]

Images showing variability in the color patterns of shells of Theodoxus fluviatilis:

From Alster, Germany.
From Güstrow, Germany.
From Zeta River, Montenegro.
From Neretva River, Bosnia and Herzegovina.

The shell shape of Theodoxus fluviatilis is similar to that of Theodoxus transversalis.[43] The shell shape of Theodoxus danubialis is more spherical.[43] The shape of the aperture of Theodoxus prevostianus is usually descending.[43] However, all of these species display a large morphological plasticity, which makes them difficult to differentiate.[43] The overall outline of the shell is still used for species identification in recent malacological literature.[43] Though the coloration and patterns of the shells cannot be relied upon to identify specimens, opercular characters can be used for a proper identification of Theodoxus fluviatilis.[43] The calcified operculum of T. fluviatilis is D-shaped, light reddish with a red margin, bearing a broad rib (also called a ridge) on its inner surface.[10][21] The columellar muscle is attached to the rib.[21] The rib is long and thin, attenuated at the base, while the callus is thin; a peg is lacking.[43] The characteristic features of the operculum are already visible in juveniles.[43] There is sexual dimorphism on the border of the rib shield of the operculum, which is straight in females, but curved in males.[43]

The outer side of an operculum.
The inner side of the same operculum.
The inner side of another operculum:
la – left adductor,
r – rib,
rs – rib shield,
ca – callus,
ra – right adductor.
The rib shield of a male.
The rib shield of a female.

Aberrations in the shape of operculum have been observed. In a specimen from Vouvant in France, and another from a spring near Bar in Montenegro, a double rib was present, but the rib shield was reduced; in a specimen from Ohrid Lake, only the rib shield was reduced.[43] Theodoxus fluviatilis can be distinguished from the other three mentioned species by having a rib pit, which is formed by the rib and the rib shield.[43] The rib shield, and consequently a rib pit, are lacking in Theodoxus transversalis, Theodoxus danubialis and Theodoxus prevostianus.[43] These three species differs in having, in addition to a rib, a peg, which is absent in T. fluviatilis.[43] The visible soft parts of the animal are light yellow with a black head.[10] The tentacles are greyish and long.[10] The eyes are large and black; the foot is whitish.[10]

Radula[edit]

One row of teeth in the radula of Theodoxus fluviatilis

Theodoxus fluviatilis, like all other species in the family Neritidae, has a radula which is of the rhipidoglossan type (a radula with many small marginal teeth which help "brush" food particles into the gullet).[44] Zettler et al. (2004)[17] and Zettler (2008)[12] made SEM micrographs of the radula of this species.

Reproductive system[edit]

Theodoxus fluviatilis has separate sexes (i.e. these snails are dioecious). The diploid number of chromosomes (2n) is 25 in males and 26 in females.[49] There is X0 sex-determination system in Neritidae, and it was confirmed for this species too.[49]

Females have two openings located under the edge of the mantle in the mantle cavity: the opening of the vagina and an opening for laying eggs. The vagina accepts the sperm during copulation. The vagina is connected to the bursa copulatrix and to the spermatheca (for storing sperm). The other opening is for laying eggs. Egg cells originate in the ovary. Egg cells travel through the oviduct to the fertilization chamber, where fertilization occur. Eggs then develop in the glandular uterus. A capsule is formed in the diverticulum next to the uterus. The eggs are then laid.[15][50]

In males, the semen is forming in the testis. The sperm structure of Theodoxus fluviatilis was examined by Gustaf Retzius.[51][52] Then semen travels through the prostate, where it mixes with prostatic fluid. Finally it goes through the vas deferens to the penis. The penis is located on the inner side of the right tentacle.[15] The following illustrations show the reproductive system in the female and in the male:

Drawing of the female reproductive system of the species, as first described (correctly) by Gustave Gilson (1896)[50] showing:
1 – ovarium
2 – oviduct
3 – uterus
4 – diverticulum
5 – connection between bursa copulatrix and uterus
6 – receptaculum seminis
7 – bursa copulatrix
8 – vagina.
Drawing of the reproductive system of a male of the species, by Lehmann (1873)[53] shows testis (on the left), prostate, vas deferens and penis (on the right).

Ecology[edit]

Habitat[edit]

Theodoxus fluviatilis prefers lowland habitats (in Switzerland it occurs up to 275 m a.s.l.) and calcium-rich waters.[43] This small snail inhabits the central and lower parts of rivers (up to 13 m deep),[10] including in brackish water[10] in tidal rivers of estuaries.[25] It sometimes lives in lakes on unvegetated bottoms.[25] Rarely it lives in springs (rheocrenes), in ground water, and in caves.[25] For example, in the Åland Islands, Theodoxus fluviatilis was found living in lakes with a pH of 7.8–8.9.[35] In streams and rivers in Ireland, the species lived in water with a pH of 7.0–8.4.[26]

The species easily attaches itself to stones, which allows it to live in fast-running waters and in wave zone in lakes.[34] The ability of Theodoxus fluviatilis to live in freshwater and also in brackish water demonstrates the phenotypic plasticity of this species.[11] This small snail can live in up to 60 m depth in coastal waters.[17] Brackish water populations can live in salinities of up to 15% in the Baltic Sea[15][33] or up to 18% in the Baltic Sea and in Black Sea.[11] Populations from brackish water can tolerate higher salinity than populations from freshwater.[17] Brackish water populations have much higher accumulation of ninhydrin-positive substances in the foot.[54]

This species lives on hard benthic substrates, typically rocks.[43] It lives on pebbles, sometimes on boulders, and rarely on dead wood.[25] It tolerates mild organic pollution, low oxygen content (down to below 2 mg/liter) but it does not tolerate long periods of droughts, or ice.[10] It lives in mesotrophic waters, and sometimes in oligotrophic waters.[25]

Theodoxus fluviatilis serves an indicator species for river monitoring (in Germany); however the spreading populations also have a high tolerance for degraded habitats.[24] Theodoxus fluviatilis has a large phenotypic plasticity: it was found living on stones and on dead wood in freshwater environments; whereas it lives on stones and on Fucus vesiculosus, Potamogeton spp. and Zostera marina in brackish water in the Baltic Sea.[17] The species can also be found on aggregates of Mytilus.[17]

This species, together with the isopod Saduria entomon, have been found to be a dominant part of the fauna biomass in the the central and northern Baltic Sea.[55] Brackish water populations can reach densities up to 200–1000 snails per m².[17] Theodoxus fluviatilis dalmaticus in Lake Ohrid can reach population densities up to 6412 snails per m².[19] The species was found in population densities of up to 9000 snails per m² in a spring of the Anços river in Central Portugal, where there is a stable temperature of 15.3–16.6 °C, which allows continuous reproduction in Theodoxus fluviatilis.[28] At Gabčíkovo port, in September 2003, a density of 34,932 juvenile snails per m² was recorded.[56]

Feeding habits[edit]

Theodoxus fluviatilis feeds mainly on diatoms on stones.[17][34] It scrapes biofilms and it consume detritus.[28] It can also consume Cyanobacteria and green algae as a poor-quality food supply.[34] Cyanobacteria contain toxins and indigestible mucopolysaccharides, and green algae have cellulose in their cell walls (Theodoxus species have no cellulase enzymes to digest cellulose).[34] They also graze on zygotes and germlings of brown alga Fucus vesiculosus, when the alga is small up to 1 mm.[57]

Peters & Traunspurger (2012) studied the effect of the grazing of Theodoxus fluviatilis on epilithic meiofauna and algae.[58]

Life cycle[edit]

Remnants of two egg capsules are visible on the surface of this corroded shell of Theodoxus fluviatilis. The width of the shell is 8 mm and the height is 6 mm.

Theodoxus fluviatilis is gonochoristic, which means that each individual animal is distinctly male or female, and cross-fertilization can occur.[25] The sex ratio is 1:1.[34] The structure of the flagellum of the spermatozoon is unique: the flagellum is divided into two parts.[59]

T. fluviatilis eggs are usually laid in from mid-April to October,[10] in temperatures above 10 °C.[34] Eggs are laid in egg capsules[25] deposited on stones and sometimes on shells of conspecific individuals.[60] Females usually lay a cluster containing 4–5 capsules.[34] A single female will usually lay about 40 capsules during summer, and about 20 capsules during autumn.[34] Fresh capsules are white,[34] but older capsules become yellow or brown and may bear an epiphytic outer layer.[34] The capsules are around 1 mm in diameter (0.9–1.1 mm),[34] but in brackish water they are usually smaller (about 0.8 mm). Empty (sterile) small capsules (0.5–0.8 mm in diameter) can also be laid.[34] The number of eggs per egg capsule changes depending on the environment. There are 100–200 eggs in each capsule in freshwater, as opposed to 55–80 eggs in each capsule in brackish water.[34] Usually, only one egg develops, with the remaining eggs serving as nutrition for the embryo,[61] which results in a single juvenile snail hatching from each capsule.[34]

Juveniles with a shell length of 0.5–1 mm hatch after 30 days (in 25 °C), or after 65 days (in 20 °C).[10][15] The ash-free dry weight of newly hatched snails is 0.012 mg.[34] The protoconch has one whorl.[21] Capsules laid in spring hatch after 2–3 months, in August–September.[34] Capsules from late summer overwinter because embryonic development ceases in temperatures below 10 °C, thus these capsules hatch in spring after 7–8 months.[34] The shell grows mainly from May to August; there is no shell growth in winter.[34] The snails reach sexual maturity in less than 1 year,[25] when the shell length is 5.5–5.7 mm.[34]

The life span of T. fluviatilis is 2–3 years.[10] The age of a few snails was estimated to be 3.5 years.[34] The mortality rate is low in summer, however the mortality rate is higher in winter because ice and storms can dislocate the substrate, which can result in mechanical damage to the snails.[34]

Parasites and predators[edit]

Parasites of Theodoxus fluviatilis include several species of trematodes. The snail serves as first intermediate host to Plagioporus skrjabini[62] and as second intermediate host to Cotylurus cornutus.[63] Asymphylodora demeli is also found in this small snail,[63] as is Notocotylus zduni.[64][65] This small snail is also parasitized by several species of ciliates. It is the main host for the ciliate Trichodina baltica; the snails are usually 100% infected in the mantle cavity[66] Another ciliate found in the mantle cavity is a species of Scyphidia.[66] Two other parasitic ciliate species found in this snail are Protospira mazurica,[67] and Hypocomella quatuor.[67] Predators of Theodoxus fluviatilis include the roach (a freshwater fish), Rutilus rutilus.[68] Theodoxus fluviatilis is also the prey of some birds.[69]

References[edit]

This article incorporates public domain text from references[3][10] and CC-BY-4.0 text from the reference[43]

  1. ^ a b c d e f g h i j k l m n o Kebapçı U. & Van Damme D. (2012). "Theodoxus fluviatilis". The IUCN Red List of Threatened Species. Version 2014.2. <www.iucnredlist.org>. Downloaded on 30 July 2014.
  2. ^ a b c d e f g h i j k "Theodoxus (Theodoxus) fluviatilis". Fauna Europaea, last update 27 January 2011, accessed 12 April 2011.
  3. ^ a b c Linnaeus C. (1758). Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 10th edition. Vermes. Testacea: 700–781. Holmiae. (Salvius). page 777.
  4. ^ (French) Montfort P. D. de (1810). Conchyliologie systématique, et classification méthodique des coquilles; offrant leurs figures, leur arrangement générique, leurs descriptions caractéristiques, leurs noms; ainsi que leur synonymie en plusieurs langues. Ouvrage destiné à faciliter l'étude des coquilles, ainsi que leur disposition dans les cabinets d'histoire naturelle. Coquilles univalves, non cloisonnées. Tome second. – pp. [1–3], 1–676. Paris. page 351.
  5. ^ a b c d e f g Anistratenko V. V. (2005). "Lectotypes for Tricolia pullus, Gibbula divaricata and Theodoxus fluviatilis (Mollusca, Gastropoda) revisited". Vestnik zoologii 39(6): 3–10. PDF .
  6. ^ (German) Lindholm W. A. (1908). "Materialien zur Molluskenfauena [sic] von Südwestrussland, Polen und der Krim". Zapiski Novorossijskago Obshchestva Estestvoispytatelej – Mémoires de la Société des Naturalistes de la Nouvelle-Russie 31: 199–232. Odessa.
  7. ^ "Species in genus Theodoxus" (n=20). AnimalBase, accessed 11 April 2011.
  8. ^ a b Anistratenko O. Y., Starobogatov Y. I. & Anistratenko V. V. (1999). "Mollusks of the genus Theodoxus (Gastropoda, Pectinibranchia, Neritidae) from the Black and the Azov seas basin". Vestnik Zoologii 33: 11–19.
  9. ^ a b Kantor Yu I., Vinarski M. V., Schileyko A. A. & Sysoev A. V. (published online on March 2, 2010). "Catalogue of the continental mollusks of Russia and adjacent territories". Version 2.3.1.
  10. ^ a b c d e f g h i j k l m n o p q r s t u "Species summary for Theodoxus fluviatilis". AnimalBase, last modified 21 September 2009, accessed 11 April 2011.
  11. ^ a b c d e f g h i j Bunje, P. M. E. (2005). "Pan-European phylogeography of the aquatic snail Theodoxus fluviatilis (Gastropoda: Neritidae)". Molecular Ecology 14 (14): 4323–4340. doi:10.1111/j.1365-294X.2005.02703.x. PMID 16313596.  edit PDF.
  12. ^ a b c d e f g h (German) Zettler M. A. (2008). "Zur Taxonomie und Verbreitung der Gattung Theodoxus Montfort, 1810 in Deutschland. Darstellung historischer und rezenter Daten einschließlich einer Bibliografie. (Taxonomy and distribution of the genus Theodoxus Montfort, 1810 in Germany. Presentation of historical and recent data including a bibliography)". Mollusca 26: 13–72. PDF
  13. ^ Neubauer, Thomas A. (2014). Theodoxus (Theodoxus) fluviatilis (Linnaeus, 1758). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=821986 on 2014-11-18
  14. ^ (Russian) Anistratenko O. Yu., Starobogatov Ya. I. & Anistratenko V. V. (1999). "Моллюски рода Theodoxus (Gastropoda, Pectinibranchia, Neritidae) Азово-Черноморского бассейна. Molluscs of the genus Theodoxus (Gastropoda, Pectinibranchia, Neritidae) from the Black and the Azov Seas basin". Vestnik Zoologii 33(3): 11–19.
  15. ^ a b c d e f g h i Glöer P. (2002). Die Süßwassergastropoden Nord- und Mitteleuropas. Die Tierwelt Deutschlands, ConchBooks, Hackenheim, 326 pp., ISBN 3-925919-60-0. pages 46–49, 51–53.
  16. ^ a b c Yildirim M. Z., Koca S. B. & Kebapçi U. (2006). "Supplement to the Prosobranchia (Mollusca: Gastropoda) Fauna of Fresh and Brackish Waters of Turkey". Turkish Journal of Zoology 30: 197–204. PDF
  17. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab Zettler M. L., Frankowski J., Bochert R. & Röhner M. (2004). "Morphological and ecological features of Theodoxus fluviatilis (Linnaeus, 1758) from Baltic brackish water and German freshwater populations". Journal of Conchology 38(3): 305–316. PDF.
  18. ^ a b Marković V., Tomović J., Ilić M., Kračun-Kolarević M., Novaković B., Paunović M. & Nikolić V. (2014). "Distribution of the species of Theodoxus Montfort, 1810 (Gastropoda: Neritidae) in Serbia: An overview". Acta Zoologica Bulgarica 66(4): 477–484. PDF.
  19. ^ a b c Smiljkov, S.; Budzakoska-Gjoreska, B.; Sapkarev, J.; Trajanovski, S. (2007). "Dominant species of the gastropod fauna from the littoral region in Lake Ohrid of R. Macedonia". Prilozi / Makedonska akademija na naukite i umetnostite, Oddelenie za bioloski i medicinski nauki = Contributions / Macedonian Academy of Sciences and Arts, Section of Biological and Medical Sciences 28 (1): 137–144. PMID 17921924.  edit
  20. ^ a b c d Bunje P. M. & Lindberg D. R. (2007). "Lineage divergence of a freshwater snail clade associated with post-Tethys marine basin development". Molecular Phylogenetics and Evolution 42(2): 373–387. doi:10.1016/j.ympev.2006.06.026.
  21. ^ a b c d Bandel K. (2001). "The history of Theodoxus and Neritina connected with description and systematic evaluation of related Neritimorpha (Gastropoda)". Mittelungen aus dem Geologisch-Palaontologischen Institut Universitat Hamburg (85): 65–164. PDF.
  22. ^ (Slovak) Lisický M. J. (1991). Mollusca Slovenska [The Slovak molluscs]. VEDA vydavateľstvo Slovenskej akadémie vied, Bratislava, 344 pp.
  23. ^ a b c d e Glöer P. & Pešić V. (2012). "The freshwater snails (Gastropoda) of Iran, with descriptions of two new genera and eight new species". ZooKeys 219: 11–61. doi:10.3897/zookeys.219.3406.
  24. ^ a b c d e f Gergs R., Koester M., Grabow K., Schöll F., Thielsch A. & Martens A. (2014). "Theodoxus fluviatilis’ re-establishment in the River Rhine: a native relict or a cryptic invader?". Conservation Genetics doi:10.1007/s10592-014-0651-7.
  25. ^ a b c d e f g h i j k l Falkner G., Obrdlík P., Castella E. & Speight M. C. D. (2001). Shelled Gastropoda of Western Europe. München: Friedrich-Held-Gesellschaft, 267 pp.
  26. ^ a b Lucey J., Mcgarrigle M. L. & Clabby K. J. (1992). "The distribution of Theodoxus fluviatilis (L.) in Ireland". Journal of Conchology 34: 91–101. abstract.
  27. ^ Theodoxus fluviatilis, accessed 25 September 2008.
  28. ^ a b c Graça M. A. S., Serra S. R. Q. & Ferreira V. (2012). "A stable temperature may favour continuous reproduction by Theodoxus fluviatilis and explain its high densities in some karstic springs". Limnetica 31(1): 129–140.
  29. ^ (German) Schultz H. & Schultz O. (2001). "Erstnachweis der Gemeinen Kahnschnecke, Theodoxus fluviatilis (LINNAEUS, 1758) in Österreich (Gastropoda: Neritidae)". Annalen des Naturhistorischen Museums in Wien 103B: 231–241. PDF.
  30. ^ Red List of the molluscs (Mollusca) of the Czech Republic
  31. ^ a b c d e f (Czech) Horsák M., Juřičková L., Beran L., Čejka T. & Dvořák L. (2010). "Komentovaný seznam měkkýšů zjištěných ve volné přírodě České a Slovenské republiky. [Annotated list of mollusc species recorded outdoors in the Czech and Slovak Republics]". Malacologica Bohemoslovaca Suppl. 1: 1–37. PDF.
  32. ^ Čejka T. & Horsák M. (2002). "First records of Theodoxus fluviatilis and Sphaerium solidum (Mollusca) from Slovakia". Biologia, Bratislava 57(5): 561–562.
  33. ^ a b Glöer P. & Meier-Brook C. (2003). Süsswassermollusken. DJN, pp. 134, pages 29, 108, ISBN 3-923376-02-2.
  34. ^ a b c d e f g h i j k l m n o p q r s t u v w x y Kirkegaard J. (2006). "Life history, growth and production of Theodoxus fluviatilis in Lake Esrom, Denmark". Limnologica 36(1): 26–41. doi:10.1016/j.limno.2005.11.002.
  35. ^ a b c Carlsson R. (2000). "The distribution of the gastropods Theodoxus fluviatilis (L.) and Potamoyrgus antipodarum (Gray) in lakes on the Åland Islands, southwestern Finland". Boreal Environment Research 5: 187–195. PDF.
  36. ^ Nagorskaya L., Moroz M., Laeno T., Veznovetz V., Pillot H. M., Dijkstra K. D. B. & Reemer M. (2002). "Macrofauna in floodplain pools and dead branches of the Pripyat river, Belarus". The Institute of Zoology NAS Belarus, 158 pp., page 56.
  37. ^ (Russian) Butenko O. (Бутенко О. И.) (2001). "Моллюски рода Theodoxus (Gastropada, Neritidae) в Одесском заливе Черного моря. [Mollusks of Theodoxus genus (Gastropoda, Neritidae) in the Odessa Bay (the Black Sea)]". Ekologiya Morya 58: 27–28. PDF.
  38. ^ Alexandrov B., Boltachev A., Kharchenko T., Lyashenko A., Son M., Tsarenko P. & Zhukinsky V. (2007). "Trends of aquatic alien species invasions in Ukraine". Aquatic Invasions 2(3): 215–242. PDF.
  39. ^ Balashov I. A., Son M. O., Coadã V. & Welter-Schultes F. (2013). "An updated annotated checklist of the molluscs of the Republic of Moldova". Folia Malacologica 21(3): 175–181.
  40. ^ Beran L. (2009). "The first record of Anisus vorticulus (Troschel, 1834) (Gastropoda: Planorbidae) in Croatia?". Malacologica Bohemoslovaca 8: 70. PDF.
  41. ^ Fehér Z. & Eröss Z. P. (2009). "Checklist of the Albanian mollusc fauna". Schriften zur Malakozoologie 25 22–38. PDF.
  42. ^ "Picture summary of Theodoxus-fluviatilis_04.jpg". AnimalBase, last modified 20 June 2008, accessed 13 April 2011.
  43. ^ a b c d e f g h i j k l m n o p q r s t u v w x y Glöer P. & Pešić V. (2015). "The morphological plasticity of Theodoxus fluviatilis (Linnaeus, 1758) (Mollusca: Gastropoda: Neritidae)". Ecologica Montenegrina 2(2): 88-92. PDF.
  44. ^ a b Brown D. S. (1994). Freshwater Snails of Africa and their Medical Importance. Taylor & Francis. ISBN 0-7484-0026-5.
  45. ^ (Portuguese) Callapez P. (2003). "Moluscos marinhos e fluviais do Paleolítico superior da Gruta do Caldeirão (Tomar, Portugal): evidências de ordem sistemática, paleobiológica e paleobiogeográfica". Revista Portuguesa de Arqueologia 6(1): 5–15. PDF.
  46. ^ (Czech) Sobotka M. (1945). "První nález zubatky říční v Čechách". Příroda, Brno, 37(5): 162.
  47. ^ (German) Ložek V. (1964). "Quartärmollusken der Tschechoslowakei". Rozpravy Ústředního ústavu geologického, Prague, 31: 374 pp., page 155.
  48. ^ Theodoxus fluviatilis. Marine Species Identification Portal, accessed 11 April 2011.
  49. ^ a b Baršienė J., Tapia G., Pujante A. M. & Martinez-Orti A. (2000). "A comparative study of chromosomes in four species of Theodoxus (Gastropoda: Neritidae)". Journal of Molluscan Studies 66(4): 535–541. doi:10.1093/mollus/66.4.535.
  50. ^ a b Gilson G. (1896) "The female organs of Neritina fluviatilis". Proceedings of the Malacological Society of London 2: 81–83.
  51. ^ Afzelius B. A. (1995). "Gustaf Retzius and spermatology". The International Journal of Developmental Biology 39: 675–685. PDF.
  52. ^ Retzius G. (1904-1921). Biologische Untersuchungen 13.
  53. ^ Lehmann R. (1873). Die lebenden Schnecken und Muscheln der Umgegend Stettins und in Pommern mit besonderer Berücksichtigung ihres anatomischen Baues. R. Friedländer & Sohn, Berlin. page 261. Plate 19, figure 94.
  54. ^ Symanowski, F.; Hildebrandt, J. P. (2009). "Differences in osmotolerance in freshwater and brackish water populations of Theodoxus fluviatilis (Gastropoda: Neritidae) are associated with differential protein expression". Journal of Comparative Physiology B 180 (3): 337–346. doi:10.1007/s00360-009-0435-4. PMID 20012055.  edit
  55. ^ Kautsky H. (1989). "Quantitative distribution of plant and animal communities of the phytobenthic zone in the Baltic Sea". Askö Laboratory, Stockholm. abstract.
  56. ^ (Slovak) Košel V. (2004). "Theodoxus fluviatilis (Gastropoda) – nový invázny druh v strednej Európe?". In: Bryja J. & Zukal J. (eds): Zoologické dny Brno, Sborník abstraktů z konference 12.-13. února 2004, page 51. ISBN 80-903329-1-9. PDF.
  57. ^ Malm T., Engkvist R. & Kautsky L. (1999). "Grazing effects of two freshwater snails on juvenile Fucus vesiculosus in the Baltic Sea". Marine Ecology Progress Series 188: 63–71. doi:10.3354/meps188063. PDF.
  58. ^ Peters L. & Traunspurger W. (2012). "Temporal patterns in macrograzer effects on epilithic algae and meiofauna: a comparative approach to test for single species and whole grazer community effects." Aquatic Sciences 74(2): 229–240. doi:10.1007/s00027-011-0214-7.
  59. ^ Giusti, F.; Selmi, M. G. (1982). "The morphological peculiarities of the typical spermatozoa of Theodoxus fluviatilis (L.) (Neritoidea) and their implications for motility". Journal of ultrastructure research 78 (2): 166–177. doi:10.1016/s0022-5320(82)80021-x. PMID 7086934.  edit
  60. ^ Örstan A. (2007). "New year, new snail: Theodoxus fluviatilis". Snail's tales. accessed 9 December 2014.
  61. ^ (Czech) Beran L. (1998). Vodní měkkýši ČR. Vlašim, 113 pp., ISBN 80-902469-4-X. page 45.
  62. ^ (Russian) Chernogorenko, M. I.; Komarovova, T. I.; Kurandina, D. P. (1978). "Life cycle of the trematode, Plagioporus skrjabini Kowal, 1951 (Allocreadiata, Opecoelidae)". Parazitologiia (in Russian) 12 (6): 479–486. PMID 733319.  edit.
  63. ^ a b Poulin R. & Chappell L. H. (2002). Parasites in Marine Systems. Parasitology, 124, Cambridge University Press, 216 pp., page S123, S128. ISBN 0521534127.
  64. ^ Gibson D. I., Bray R. A. & Harris E. A. (Compilers) (2005). "Host-Parasite Database". Natural History Museum, London,
  65. ^ Kostadinova A. (1993). Trematodes and trematode communities in fish-eating birds from the Bulgarian Black Sea coast. Bulgarian Academy of Sciences, Parazitologiia Institut, 5 pp.
  66. ^ a b Raabe Z. (1965). "The parasitic ciliates of gastropods in the Ohrid Lake". Acta Protozoologica 3: 311–3. PDF.
  67. ^ a b Raabe Z. (1968). "Two new species of Thigmotricha (Cliata, Holotricha) from Theodoxus fluviatilis. Acta Protozoologica 6: 170–173. PDF
  68. ^ Lappalainen A., Rask M., Koponen H. & Vesala S. (2001). "Relative abundance, diet and growth of perch (Perca fluviatilis) and roach (Rutilus rutilus) at Tvärminne, northern Baltic Sea, in 1975 and 1997: responses to eutrophication?" Boreal Environment Research 6: 107–118. PDF.
  69. ^ Kiss J. B., Rékási J. & Richnovszky A. (1995). "Data on the mollusc (Mollusca) consumption of birds in the Danube Delta, Romania". Aquila 102: 99–107. PDF.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!