Overview

Distribution

Range Description

This species is the most widely distributed species of the Theodoxus genus. The freshwater subspecies T. fluviatilis fluviatilis is widespread, with a Western Palaearctic range, occurring principally in the lowlands of northern, central and eastern Europe and southern Sweden to 60 degrees north. It is widespread in suitable habitats across Europe from western Russia eastwards to the Iberian peninsula and from the Balkan peninsula in the south to southern Scandinavia in the north (Zettler et al. 2004). The range of this species occurs as far as Ireland to the west (Lucey et al. 1992), and as far as the Scottish Orkney islands to the north (Zettler et al. 2004). It also occurs in lowland areas of Anatolia (Yildirim 1999). It is now expanding towards the Black Sea Basin and the Carpathian Basin where this species is invasive. There are large areas across Europe in which this species is absent, in particular in mountainous areas (Bunje 2005). This species is absent in Norway and is only present in Finland on the Åland islands (Zettler et al. 2004). It has also become extinct in the Czech Republic (Farkac et al. 2005).

The subspecies T. fluviatilis littoralis is present in the North Sea in brackish waters of the Orkney islands and the Netherlands, and in low salinity waters of the Baltic Sea (Zettler et al. 2004). It also occurs in the Black Sea in waters with a salt content below 18% (Butenko 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Theodoxus fluviatilis is considered holarctic, occurring in both the Nearctic and Palearctic biogeographic regions. However, they are more commonly seen in the Palearctic region, spreading far west to England, and east into southwestern Asia. Many patches within Europe are uninhabited, mainly the mountainous regions. This snail's ability to survive in freshwater allowed for migration throughout Eastern Europe, and later re-entry into the brackish waters of the Baltic Sea.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

Other Geographic Terms: holarctic

  • Bunje, P. 2005. Pan-European phylogeography of the aquatic snail Theodoxus fluviatilis (Gastropoda: Neritidae). Molecular Ecology, 14: 4323-4340. Accessed May 23, 2011 at http://paulbunje.com/pdfs/Bunje2005.pdf.
  • Symanowski, F., J. Hildebrandt. 1984. Differences in osmotolerance in freshwater and brackish water populations of Theodoxus fluviatilis (Gastropoda: Neritidae) are associated with differential protein expression. Journal of Comparative Physiology, 180 (3): 337-346.
  • Zettler, M., J. Frankowski, R. Bochert, M. Rohner. 2004. Morphological and ecological features of Theodoxus fluviatilis (Linnaeus, 1758) from Baltic brackish water and German freshwater populations. Journal of Conchology, 38 (3): 305-316. Accessed May 11, 2011 at http://www.io-warnemuende.de/tl_files/bio/ag-benthische-organismen/pdf/zettler_et_al-2004-theodoxus.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread throughout Europe from the British Isles and Spain to the Caucasus and the Black Sea, and from the Baltic Sea to Italy.  Reported from Turkey (Bafra and Sinop on the southern coast of the Black Sea, Öktener, 2004), but these findings are probably the very similar Theodoxus  heldreichi (von Martens, 1879).     

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Eichhorst, Thomas

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Although difficult to distinguish between different species of Theodoxus, Theodoxus fluviatilis has a few main morphological features used for identification. These include size, color patterns of the periostracum, the operculum and the radula. The common river nerite has a soft-tissued body encased within a round, calcareous shell. This species is known to absorb the inner walls of the shell, thus allowing for a more spacious environment inside the shell. This absorption may allow more room for their food intake. The operculum, a hard, proteinaceous plate protecting the body when fully retracted within the shell, is light red with broad ribs. The margin of the operculum is red.

The species has an average mass of 50 mg, an average shell length of 9 mm, and an average shell width of 6 mm. The different specimens, marine and freshwater, show some morphological variances. Freshwater specimens tend to be larger and thicker than the marine forms. Freshwater specimens also have a yellowish-green color, while marine forms are mostly black. Since they are dioecious, the male and female sexes are separate. Both have reproductive organs. The male's penis is located on the right side of their body, near the base. The female reproductive organs are located inside the mantle cavity. Within the mantle cavity, females have two openings, one for fertilization and the other for discharging their eggs.

Range mass: .025 to .345 g.

Average mass: .050 g.

Average length: 9 mm.

Average wingspan: 6 mm.

Range basal metabolic rate: 1 to 8 cm^3 oxygen/hour.

Average basal metabolic rate: 5 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found in rivers, larges lakes, estuarine section of rivers, brackish coastal waters and springs (within the Mediterranean part of the range). It requires a solid surface such as rocks, concrete, stones to be able to attach itself to. The species displays wide polymorphism in shell pattern and colour, making it difficult to identify (Anistratenko 2005).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Commonly known as the river nerite, Theodoxus fluviatilis was first discovered in saltwater, originating in the Black Sea. Currently this species is mainly found in freshwater streams and rivers. The river nerite is also found along coastal regions of the Black and Baltic Seas, and also lives in estuaries, regions where freshwater rivers meet saltwater seas. Within this habitat, it lives on hard benthic substrates, typically rocks and submerged wood, and in calcium-rich waters. Theodoxus fluviatilis also lives as deep as 60 meters below the surface, and is sometimes found no higher than a centimeter above the water surface.

Average elevation: .01 m.

Range depth: 0 to 60 m.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 22
  Temperature range (°C): 8.600 - 8.600
  Nitrate (umol/L): 1.265 - 1.265
  Salinity (PPS): 7.618 - 7.618
  Oxygen (ml/l): 8.061 - 8.061
  Phosphate (umol/l): 0.326 - 0.326
  Silicate (umol/l): 11.134 - 11.134

Graphical representation

Depth range (m): 1 - 22
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marine to freshwater, under stones or wood in river systems of Europe, especially in running water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Eichhorst, Thomas

Source: Neritopsine Gastropods LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

As Theodoxus fluviatilis is an herbivore and a detritivore, it mainly feeds on phytoplankton (mainly diatoms), but also feeds on detritus and a variety of algae. Its radula is specialized to grind even the hardest phytoplankton, making it easier to digest. Detritus is the organic material that comes from dead or decomposing plants or animals. While developing, the larva will feed within the egg capsule.

Plant Foods: algae; phytoplankton

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: herbivore (Algivore); detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Theodoxus fluviatilis plays an important role for the health and maintenance of large structuring macrophytes. They aid the growth of the perennial brown alga, Fucus vesiculosus. While other grazers inhibit the ability of Fucus to uptake nitrogen, T. fluviatilis does not, and thus aids in the growth of the algae. Not much is known about their symbiotic relationships with other animals.

  • Kautsky, L., S. Raberg. 2008. Grazer identity is crucial for facilitating growth of the perennial brown alga Fucus vesiculosus. Marine ecology process series, 361: 111-118.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Because their hard calcareous shell completely covers their body, most predators avoid Theodoxus fluviatilis as a potential food source. Their eggshells are also calcified and hardened, thus protecting them when predators attack. However, a few known predators include the European perch, Perca flavescens, as well as two crayfishes, Orconectes limosus and Astacus astacus. These animals have adaptations that allow them to break through the snails' calcareous shell. Orconectes limosus, endemic to North America, is an invasive species in Europe.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like many other gastropods, Theodoxus fluviatilis has a well-developed nervous system. Sense organs include eyes, statocysts, tactile organs, and chemoreceptors. Statocysts are fluid-filled cellular cysts used to sense direction of gravity, and thus sense equilibrium. Chemoreceptors are used to detect chemical stimuli. The snails also have a pair of eyes, each located at the end of their antennae that give them a visual sense perception of their habitat. Thus, they see their environment, sense movement, and also sense their state of balance.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Theodoxus fluviatilis develops in a similar manner as most other gastropods, however, the snail develops within the egg, so there is no larval form. The shell forms as the egg is developing. Initially, the mouth is anterior and the anus is posterior. However, after a process known as torsion, the positions of the body parts change.

Torsion involves two steps, each being a 90 degree rotation. The first rotation is caused by a contraction of the foot retractor muscle. It rotates the shell and visceral mass 90-degrees counterclockwise, leaving the anus on the right side of the body. The second rotation is caused by further development of differentiating tissues. This allows for the mantle cavity to develop near the anus and an additional 90-degree rotation, placing the anus directly above the head and mouth.

The positioning of the anus above the head would normally result in sanitary problems, with wastes washing directly over the gills. However, this is resolved by another process known as coiling. Coiling is not the same as torsion, however it can occur at the same time in development as torsion. Coiling of the shell and visceral mass allow for the loss of the gill, auricle, and kidney, all on the right side of the mantle cavity, and thus allow the snails to avoid sanitation problems. Since the water-flow through the mantle cavity is unidirectional, it flows into the left side and out of the right side, carrying with it wastes from the anus, which is near the right side. The single gill on the left side is then exposed only to clean water, avoiding any such sanitation problems. Once eggs hatch, they are considered miniature adults and take 18 months to fully mature into adult snails.

  • Orton, R., R. Sibley. 1990. Egg size and growth rate in Theodoxus fluviatilis (L). Functional Ecology, 4 (1): 91-94. Accessed May 22, 2011 at http://www.jstor.org/stable/2389657.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Theodoxus fluviatilis lives in nature for approximately two to three years. Longevity in an aquarium kept at room temperature has been recorded as two years.

Range lifespan

Status: wild:
3.5 (high) years.

Range lifespan

Status: captivity:
2 (high) years.

Typical lifespan

Status: wild:
2 to 3 years.

Average lifespan

Status: captivity:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Theodoxus fluviatilis reproduces between April and October. These snails have separate sexes and reproduce sexually. The male reproductive organ is located on the right side of its body. The female reproductive organs are within the mantle cavity. In the mantle cavity, there are two openings, one for fertilization and another for discharging the eggs. Fertilization is internal. The nerites are oviparous, females laying calcified eggs, normally on benthic surfaces or on their shell near the opening.

Mating System: monogamous

Theodoxus fluviatilis are dioecious and oviparous. They are semelparous, producing offspring all at once, after which the parent usually dies. During their mating season, anywhere from 50 to 200 eggs are laid. These eggs are collectively known as a capsule, and only one of them contains an embryo. Each egg is made of two spherical halves, which split when newborns hatch. The rest are used as a food source for the newborns. Embryos usually take about 100 days to fully develop. Since they are involved in a biennial life cycle, their eggs hatch some time in the fall as miniature adults and fully mature 18 months later.

Breeding interval: They breed once in their lifetime, and they usually die after.

Breeding season: They breed between the warmer months of April and October.

Range number of offspring: 50 to 200.

Average age at sexual or reproductive maturity (female): 18 months.

Average age at sexual or reproductive maturity (male): 18 months.

Key Reproductive Features: semelparous ; sexual ; fertilization (Internal ); oviparous

Not much is known on the parental investment of T. fluviatilis, but some were found with their eggs attached to their shell near the opening. This could be some form of protection of the eggs from possible predators or even by providing nutrients to their young. The young are precocial when they hatch.

Parental Investment: precocial ; pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Theodoxus fluviatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 45 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTTGGTGTTTGATCAGGGTTAGTTGGAACTGCTTTAAGTTTGTTAATTCGAGCGGAACTTGGGCAGCCTGGTGCTTTATTAGGGGAT---GACCAGCTTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTCTTGTGATGCCTATAATAATTGGAGGTTTTGGTAATTGATTGGTTCCATTAATGTTAGGAGCTCCTGATATGGCATTTCCTCGGTTAAATAACATGAGTTTTTGGCTTCTTCCTCCNTCACTTACTTTATTGTTGGCTTCATCTGCAGTGGAAAGTGGGGTTGGTACTGGCTGAACTGTATACCCTCCTTTATCTGGAAATTTAGCTCATGCGGGAGGTTCTGTTGATTTAGCTATTTTTTCTCTACATTTGGCTGGTGTATCTTCTATTTTAGGGGCTGTTAATTTCATTACTACAATTATTAATATGCGATGACAAGGGATGCAATTTGAGCGATTGCCTTTATTTGTCTGATCTGTAAAAATTACTGCAATTTTATTATTATTATCTTTACCTGTGCTTGCTGGAGCAATTACTATACTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGTGGTGGTGATCCAATTTTATATCAGCACTTGGTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Theodoxus fluviatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Kebapçı, U. & Van Damme, D.

Reviewer/s
Bohm, M., Collen, B. & Seddon, M.

Contributor/s
Seddon, M., Killeen, I., Offord, S., Duncan, C., Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., De Silva, R., Milligan, HT, Herdson, R., Thorley, J., Collins, A., McMillan, K. & Richman, N.

Justification
This is a widespread species which is both very common in certain parts of its range and is relatively tolerant to pollution; it is continuing to spread in the Danube drainage. Therefore it is assessed as Least Concern.

This species has been assessed at the regional level:
EU27 regional assessment: Least Concern (This species is categorised as Least Concern in the 27 member states of the European Union)
European regional assessment: Least Concern
Mediterranean regional assessment : Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Theodoxus fluviatilis are considered extinct in the Czech Republic. They are also endangered in Switzerland and Latvia, and considered in jeopardy in other European countries including the Netherlands and Slovenia. They are also protected under law in Latvia.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In some parts of its range this species is known to be very common (Zettler et al. 2004). The trends are unknown over the range, but some countries report a decline. In other parts of the region it is expanding, for example in the Danube in western Slovakia (Čejka et al. 2006). The species has a life span of 2-3 years and the eggs are laid from mid-April to October, with juveniles hatching after 30 - 60 days.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The principal threats to the species are pollution of its habitats through eutrophication or other chemical sources, alteration of water courses, changes to flow regimes, and over-frequent dredging, however these threats don't seem to create major declines in the species. Mouthon (1996) showed that T. fluviatilis was relatively insensitive to biodegradable pollution. In the Danube, where it is an invasive species, it is replacing the original Theodoxus spp., as it seems to tolerate the polluted waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation efforts known for this species.

In Red Lists of Latvia, Italy, UK, and the Republic of Ireland it is viewed as Least Concern. In The Netherlands it was considered to be Vulnerable. In Switzerland the species was considered to be highly threatened (CR equivalent), and in Czech Republic it is listed as Extinct (Farkac et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Theodoxus fluviatilis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Theodoxus fluviatilis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Theodoxus fluviatilis

Theodoxus fluviatilis, common name the river nerite, is a species of small freshwater and brackish water snail with a gill and an operculum, an aquatic gastropod mollusk in the family Neritidae, the nerites.

Theodoxus fluviatilis is the type species of the genus Theodoxus.[4] Anistratenko (2005)[4] designated the lectotype for Theodoxus fluviatilis.[4]

Subspecies[edit]

Several subspecies are (inconsistently) recognized by various authors:

Bunje (2005)[8] does not consider Theodoxus velox Anistratenko, 1999[13] to be a distinct species from Theodoxus fluviatilis.[8]

Distribution[edit]

The distribution of this species is European.[14] Its distribution is scattered in Europe and in Western Asia[4] except the Alps and regions immediately north of the Alps.[7] It does not live in Norway.[7][11] Theodoxus fluviatilis has the most widespread distribution of all species in the genus Theodoxus.[8]

Western Europe:

Central Europe:

Northern Europe:

Eastern Europe:

Two views of a shell of Theodoxus fluviatilis from Krokees, Greece.[26]

Southern Europe:

Asia:

Bunje (2005)[8] hypothetized that the ancestral range of Theodoxus fluviatilis was the Ponto-Pannonian region (southern Ukraine, Romania and Hungary).[8] Firstly it colonized northern Italy, Greece and Turkey; in the second phase it colonized Spain, France and Germany.[8] Finally in the Holocene it colonized the British Isles, Sweden and the Baltic Sea.[8]

Shells of Theodoxus fluviatilis have also been found in the following sites:

Description[edit]

One row of teeth in the radula of Theodoxus fluviatilis

Theodoxus fluviatilis was originally described (under the name Nerita fluviatilis) by Carl Linnaeus in 1758. Linnaeus's original text (the type description) was very short, and reads as follows:[3]

Nerita fluviatilis, n. 632: testa rugosa, labiis edentilis. Habitat in Europa cataractis.

The shell is depressed, strongly calcified and with three whorls.[15][30] It is basically whitish or yellowish with dark reddish or violetish reticulate pattern, very variably arranged (adapted to environmental factors), sometimes partly in bands, occasionally evenly dark.[7] It is very variable in colors and in color patterns (it has great polymorphism in colors).[4] In the Mediterranean region there are slightly different forms.[7] The shell may be corroded.[11] Operculum is light reddish with red margin,[7] with broad rib and without apophysis.[7]

The width of the shell is 5-9 mm,[7] up to 11 mm[19] or up to 13 mm.[7] The height of the shell is 4-6.5 mm,[7] or up to 7 mm.[19]

The maximum width of the shell of freshwater population is 13.1 mm.[11] The maximum height of the shell of freshwater population is 9.3 mm.[11] The maximum weight of the shell is 343 mg.[11]

The maximum width of the shell of brackish water population is 9.3 mm.[11] The maximum height of the shell of brackish water population is 5.8 mm.[11] The maximum weight of the shell is 124 mg.[11]

The animal is light yellow with head black.[7] Tentacles are greyish and long.[7] Eyes are big and black, foot is whitish.[7]

Drawing of the reproductive system of a male by Lehmann (1873)[31] shows testis (on the left), prostate, vas deferens and penis (on the right).
Drawing of the reproductive system as firstly described (correctly) by Gustave Gilson (1896)[32] of a female shows:
1 - ovarium
2 - oviduct
3 - uterus
4 - diverticulum
5 - connection between bursa copulatrix and uterus
6 - receptaculum seminis
7 - bursa copulatrix
8 - vagina.

Ecology[edit]

This small snail inhabits the central and lower parts of rivers (up to 13 m deep),[7] also in brackish water[7] in tidal rivers of the estuary.[15] Sometimes it lives in lakes on unvegetated bottom.[15] It rarely lives in springs (rheocrenes), in ground water and in caves.[15] For example there was pH 7.8-8.9 in lakes in Åland Islands with Theodoxus fluviatilis.[22]

The ability of Theodoxus fluviatilis to live in freshwater and also in brackish water is a representation of phenotypic plasticity of this species.[8] It can live up to 60 m depth in coastal waters.[11] Brackish water populations can live in salinity up to 15 ‰ in the Baltic Sea[9][20] or up to 18 ‰ in the Baltic Sea and in the Black Sea.[8] Populations from brackish water tolerates higher salinity than populations from freshwater.[11] Brackish water populations have much higher accumulation of ninhydrin-positive substances in the foot.[33]

This species requires a stony substrate.[7] It lives on pebbles, sometimes on boulders and rarely on dead wood.[15] It tolerates mild organic pollution, low oxygen content (down to below 2 mg/liter) but does not tolerate long periods of droughts or ice.[7] It lives in mesotrophic waters, sometimes in oligotrophic.[15] Theodoxus fluviatilis has large phenotypic plasticity and it was found to be living on stones and on the dead wood in freshwater environment; while it lives on stones and on Fucus vesiculosus, Potamogeton spp. and Zostera marina in brackish water in the Baltic Sea.[11] It can also occur on aggregates of Mytilus.[11]Theodoxus fluviatilis together with the isopod Saduria entomon has been found to be a dominant part of the fauna biomass in the central and northern Baltic Sea.[34] Brackish water populations can reach densities up to 200-1000 snails per m².[11] Theodoxus fluviatilis dalmaticus in Lake Ohrid can reach population densities up to 6412 snails per m².[12]

It feeds on algae cover[7] and diatoms on stones.[11]

Sexes are separate (dioecious) and cross-fertilization occurs.[15] There is unique structure of the flagellum of spermatozoon: the flagellum is divided into two parts.[35] Eggs are laid in an egg mass[15] from mid-April to October.[7] There are less than 10 eggs.[15] Only one egg develops and other eggs serve as nutrition for the embryo.[36]

0.5-1 mm sized juveniles hatch after 30 days (in 25°C) or after 65 days (in 20°C).[9][7] Sexual maturity is in less than 1 year.[15] The life span is 2-3 years.[7]

Parasites of Theodoxus fluviatilis include:

This species is threatened mainly by river engineering, and water pollution in densely populated regions.[7]

References[edit]

This article incorporates public domain text from references[3][7]

  1. ^ 2006 IUCN Red List of Threatened Species. <www.iucnredlist.org>. Cited 14 June 2007.
  2. ^ a b c d e f g h i j "Theodoxus (Theodoxus) fluviatilis". Fauna Europaea, last update 27 January 2011, accessed 12 April 2011.
  3. ^ a b c Linnaeus C. (1758). Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 10th edition. Vermes. Testacea: 700-781. Holmiae. (Salvius). page 777.
  4. ^ a b c d e f g Anistratenko V. V. (2005). "Lectotypes for Tricolia pullus, Gibbula divaricata and Theodoxus fluviatilis (Mollusca, Gastropoda) revisited". Vestnik zoologii 39(6): 3-10. PDF .
  5. ^ "Species in genus Theodoxus" (n=20). AnimalBase, accessed 11 April 2011.
  6. ^ a b Kantor Yu I., Vinarski M. V., Schileyko A. A. & Sysoev A. V. (published online on March 2, 2010). "Catalogue of the continental mollusks of Russia and adjacent territories". Version 2.3.1.
  7. ^ a b c d e f g h i j k l m n o p q r s t u v w x y "Species summary for Theodoxus fluviatilis". AnimalBase, last modified 21 September 2009, accessed 11 April 2011.
  8. ^ a b c d e f g h i j k Bunje, P. M. E. (2005). "Pan-European phylogeography of the aquatic snail Theodoxus fluviatilis (Gastropoda: Neritidae)". Molecular Ecology 14 (14): 4323–4340. doi:10.1111/j.1365-294X.2005.02703.x. PMID 16313596.  edit PDF.
  9. ^ a b c d e Glöer P. (2002). Die Süßwassergastropoden Nord- und Mitteleuropas. Die Tierwelt Deutschlands, ConchBooks, Hackenheim, 326 pp., ISBN 3-925919-60-0.
  10. ^ a b c Yildirim M. Z., Koca S. B. & Kebapçi U. (2006). "Supplement to the Prosobranchia (Mollusca: Gastropoda) Fauna of Fresh and Brackish Waters of Turkey". Turkish Journal of Zoology 30: 197-204. PDF
  11. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z Zettler M. L., Frankowski J., Bochert R. & Röhner M. (2004). "Morphological and ecological features of Theodoxus fluviatilis(Linnaeus, 1758) from Baltic brackish water and German freshwater populations". Journal of Conchology 38(3): 305-316.PDF.
  12. ^ a b c Smiljkov, S.; Budzakoska-Gjoreska, B.; Sapkarev, J.; Trajanovski, S. (2007). "Dominant species of the gastropod fauna from the littoral region in Lake Ohrid of R. Macedonia". Prilozi / Makedonska akademija na naukite i umetnostite, Oddelenie za bioloski i medicinski nauki = Contributions / Macedonian Academy of Sciences and Arts, Section of Biological and Medical Sciences 28 (1): 137–144. PMID 17921924.  edit. PDF.
  13. ^ Anistratenko O. Y., Starobogatov Y. I. & Anistratenko V. V. (1999). "Mollusks of the genus Theodoxus (Gastropoda, Pectinibranchia, Neritidae) from the Black and the Azov seas basin". Vestnik Zoologii 33: 11-19.
  14. ^ (Slovak) Lisický M. J. (1991). Mollusca Slovenska [The Slovak molluscs]. VEDA vydavateľstvo Slovenskej akadémie vied, Bratislava, 344 pp.
  15. ^ a b c d e f g h i j k l m Falkner G., Obrdlík P., Castella E. & Speight M. C. D. (2001). Shelled Gastropoda of Western Europe. München: Friedrich-Held-Gesellschaft, 267 pp.
  16. ^ Theodoxus fluviatilis, accessed 25 September 2008
  17. ^ (German) Schultz H. & Schultz O. (2001). "Erstnachweis der Gemeinen Kahnschnecke, Theodoxus fluviatilis (LINNAEUS, 1758) in Österreich (Gastropoda: Neritidae)". Annalen des Naturhistorischen Museums in Wien 103B: 231-241. PDF.
  18. ^ Red List of the molluscs (Mollusca) of the Czech Republic
  19. ^ a b c d e f (Czech) Horsák M., Juřičková L., Beran L., Čejka T. & Dvořák L. (2010). "Komentovaný seznam měkkýšů zjištěných ve volné přírodě České a Slovenské republiky. [Annotated list of mollusc species recorded outdoors in the Czech and Slovak Republics]". Malacologica Bohemoslovaca Suppl. 1: 1-37. PDF.
  20. ^ a b Glöer P. & Meier-Brook C. (2003). Süsswassermollusken. DJN, pp. 134, pages 29, 108, ISBN 3-923376-02-2.
  21. ^ Čejka T. & Horsák M. (2002). "First records of Theodoxus fluviatilis and Sphaerium solidum (Mollusca) from Slovakia". Biologia, Bratislava 57(5): 561-562.
  22. ^ a b c Carlsson R. (2000). "The distribution of te gastropods Theodoxus fluviatilis (L.) and Potamoyrgus antipodarum (Gray) in lakes on the Åland Islands, southwestern Finland". Boreal Environment Research 5: 187-195. PDF.
  23. ^ Nagorskaya L., Moroz M., Laeno T., Veznovetz V., Pillot H. M., Dijkstra K. D. B. & Reemer M. (2002). "Macrofauna in floodplain pools and dead branches of the Pripyat river, Belarus". The Institute of Zoology NAS Belarus, 158 pp., page 56. PDF.
  24. ^ (Russian) Butenko O. (Бутенко О. И.) (2001). "Моллюски рода Theodoxus (Gastropada, Neritidae) в Одесском заливе Черного моря. [Mollusks of Theodoxus genus (Gastropoda, Neritidae) in the Odessa Bay (the Black Sea)]". Ekologiya Morya 58: 27-28. PDF.
  25. ^ Alexandrov B., Boltachev A., Kharchenko T., Lyashenko A., Son M., Tsarenko P. & Zhukinsky V. (2007). "Trends of aquatic alien species invasions in Ukraine". Aquatic Invasions 2(3): 215-242. PDF.
  26. ^ a b "Picture summary of Theodoxus-fluviatilis_04.jpg". AnimalBase, last modified 20 June 2008, accessed 13 April 2011.
  27. ^ Beran L. (2009). "The first record of Anisus vorticulus (Troschel, 1834) (Gastropoda: Planorbidae) in Croatia?". Malacologica Bohemoslovaca 8: 70. PDF.
  28. ^ Fehér Z. & Eröss Z. P. (2009). "Checklist of the Albanian mollusc fauna". Schriften zur Malakozoologie 25 22-38. PDF.
  29. ^ (Portuguese) Callapez P. (2003). "Moluscos marinhos e fluviais do Paleolítico superior da Gruta do Caldeirão (Tomar, Portugal): evidências de ordem sistemática, paleobiológica e paleobiogeográfica". Revista Portuguesa de Arqueologia 6(1): 5-15. PDF.
  30. ^ Theodoxus fluviatilis. Marine Species Identification Portal, accessed 11 April 2011.
  31. ^ Lehmann R. (1873). Die lebenden Schnecken und Muscheln der Umgegend Stettins und in Pommern mit besonderer Berücksichtigung ihres anatomischen Baues. R. Friedländer & Sohn, Berlin. page 261. Plate 19, figure 94.
  32. ^ Gilson G. (1896) "The female organs of Neritina fluviatilis". Proceedings of the Malacological Society of London 2: 81-83.
  33. ^ Symanowski, F.; Hildebrandt, J. P. (2009). "Differences in osmotolerance in freshwater and brackish water populations of Theodoxus fluviatilis (Gastropoda: Neritidae) are associated with differential protein expression". Journal of Comparative Physiology B 180 (3): 337–346. doi:10.1007/s00360-009-0435-4. PMID 20012055.  edit
  34. ^ Kautsky H. (1989). "Quantitative distribution of plant and animal communities of the phytobenthic zone in the Baltic Sea". Askö Laboratory, Stockholm. [1].
  35. ^ Giusti, F.; Selmi, M. G. (1982). "The morphological peculiarities of the typical spermatozoa of Theodoxus fluviatilis (L.) (Neritoidea) and their implications for motility". Journal of ultrastructure research 78 (2): 166–177. PMID 7086934.  edit
  36. ^ (Czech) Beran L. (1998). Vodní měkkýši ČR. Vlašim, 113 pp., ISBN 80-902469-4-X. page 45.
  37. ^ (Russian) Chernogorenko, M. I.; Komarovova, T. I.; Kurandina, D. P. (1978). "Life cycle of the trematode, Plagioporus skrjabini Kowal, 1951 (Allocreadiata, Opecoelidae)". Parazitologiia (in Russian) 12 (6): 479–486. PMID 733319.  edit.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!