Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1910:
 - [[ worker ]]. - Long. 6,8 mill. - Mandibules mates, densement ponctuees, pubescentes, seulement un peu plus longues que larges, a bord terminal tranchant. Epistome transversalement concave, assez nettement delimite derriere. Aire frontale grande, triangulaire, plus haute que large, indistincte., Sillon frontal etale en large gouttiere et atteignant le quart posterieur de la tete. Tete un peu plus longue que large et fortement retrecie devant les yeux, elargie derriere, tronquee et concave a l'occiput, de sorte que les angles posterieurs sont droits ou presqueaigus, les bords etant presque droits de l' oe il a l'angle posterieur. Yeux grands, convexes, occupant plus du quart de la longueur de la tete et situes aux 2 / 5 anterieurs. Le scape atteint exactement le bord posterieur tronque. Articles 5 a 8 du funicule un peu plus epais que longs; le second article aussi long que le premier. Angles anterieurs du pronotum obtus, mais distincts. Dos du thorax allonge, mais assez plat, subborde, pas ou a peine convexe sur le profil. Suture promesonotale distincte; suture mesoepinotal obsolete. Pronotum plus long que large. Mesoepinotum plus de deux fois plus long que large, Face declive de l'epinotum fortement creusee, avec un rebord lateral aigu. Vue de dessus, la face basale est largement echancree au milieu de son bord posterieur, le milieu de l'echancrure passant a la face declive par un bord obtus, tandis que ses cotes tout faiblement releves en oreilles. N oe ud du pedicule allonge, presque cylindrique, presque deux fois plus long que large, faiblement attenue et abaisse en courbe devant, verticalement tronque derriere. Le bord de la surface plane tronquee est aigu, a peine avance en arriere et en haut. Abdomen fortement retreci apres le premier segment qui est legerement moins large et moins long que le second.
 Mate; tres densement et finement ponctuee. Abdomen et pattes subopaques, a ponctuation moins profonde. Les points ont partout une tendance a s'aligner en rides ou stries presque microscopiques.
 En outre de gros points espaces, effaces partout. Pilosite dressee nulle Pubescence fine, courte, jaunatre, espacee partout.
 Noire; pattes, antennes, mandibules et lobe anterieur des aretes frontales d'un rougeatre terne.
 Montagnes de l'Amber, nord de Madagascar, recue par M. Rolle.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ worker ]]. - Long. 6,8 mill. - Mandibules mates, densement ponctuees, pubescentes, seulement un peu plus longues que larges, a bord terminal tranchant. Epistome transversalement concave, assez nettement delimite derriere. Aire frontale grande, triangulaire, plus haute que large, indistincte., Sillon frontal etale en large gouttiere et atteignant le quart posterieur de la tete. Tete un peu plus longue que large et fortement retrecie devant les yeux, elargie derriere, tronquee et concave a l'occiput, de sorte que les angles posterieurs sont droits ou presqueaigus, les bords etant presque droits de l' oe il a l'angle posterieur. Yeux grands, convexes, occupant plus du quart de la longueur de la tete et situes aux 2 / 5 anterieurs. Le scape atteint exactement le bord posterieur tronque. Articles 5 a 8 du funicule un peu plus epais que longs; le second article aussi long que le premier. Angles anterieurs du pronotum obtus, mais distincts. Dos du thorax allonge, mais assez plat, subborde, pas ou a peine convexe sur le profil. Suture promesonotale distincte; suture mesoepinotal obsolete. Pronotum plus long que large. Mesoepinotum plus de deux fois plus long que large, Face declive de l'epinotum fortement creusee, avec un rebord lateral aigu. Vue de dessus, la face basale est largement echancree au milieu de son bord posterieur, le milieu de l'echancrure passant a la face declive par un bord obtus, tandis que ses cotes tout faiblement releves en oreilles. N oe ud du pedicule allonge, presque cylindrique, presque deux fois plus long que large, faiblement attenue et abaisse en courbe devant, verticalement tronque derriere. Le bord de la surface plane tronquee est aigu, a peine avance en arriere et en haut. Abdomen fortement retreci apres le premier segment qui est legerement moins large et moins long que le second.

 

Mate; tres densement et finement ponctuee. Abdomen et pattes subopaques, a ponctuation moins profonde. Les points ont partout une tendance a s'aligner en rides ou stries presque microscopiques.

 

En outre de gros points espaces, effaces partout. Pilosite dressee nulle Pubescence fine, courte, jaunatre, espacee partout.

 

Noire; pattes, antennes, mandibules et lobe anterieur des aretes frontales d'un rougeatre terne.

 

Montagnes de l'Amber, nord de Madagascar, recue par M. Rolle.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Platythyrea arthuri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTAGCAATTTGAGCTGGAATAATTGGAACGTCTATAAGAATAATTATTCGATTAGAATTAGGTACTTGTGAATCAATTATTATAAATGATCAAATTTATAATTCAATAATTACAAGTCATGCTTTTATTATAATTTTCTTTATAGTTATACCATTTATAATTGGTGGATTTGGAAATTTTTTAATCCCATTAATATTAAGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTATTACCTCCTTCTCTTATTTTATTATTAATAAGTAGTTTTACTTATCAAGGAGTTGGTACTGGTTGAACAGTGTACCCCCCATTATCATCTAATATATTTAACAGAAGACCATCAGTAGATTTAACTATCTTTTCTTTACATATTGCAGGATTATCCTCAATTATAGGATCTATTAATTTCATCTCTACAATTTTAAATATACATCATAAAAATTTATCTATAGAAAAAATTCCATTACTAGTATGAGCAATCCTTATTACAACTATTTTACTTTTACTCTCATTACCAGTTCTTGCTGGAGCTATCACTATATTATTAACAGATCGAAATTTTAACACATCTTTTTTTGACCCCTCAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Platythyrea arthuri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!