Overview

Distribution

Range Description

This species is originally native to the Ponto-Caspian region, and has since expanded its range across Europe, becoming a common component of many lakes and rivers (Mastitsky 2007, Tyutin and Slynko 2010). The invasion of species from the Ponto-Caspian region throughout Europe has been facilitated via inland migration corridors (Bij de Vaate et al. 2002) and the main range extension of this species has taken place in the 19th to 20th century (Mouthon 2007). The recent expansion in north-east Europe is spectacular; having been introduced in the Volga delta in the 1990s, the species has presently reached a number of deltas in the Upper Volta (Tyutin and Slynko 2007). This species is widespread, occuring from eastern France and the Netherlands, to Ukraine and Russia, north to Latvia and south to Bosnia and Herzegovina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Lithoglyphus naticoides (Pfeiffer, 1828)
Catalog Number: USNM 188241
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): King
Year Collected: 1848
Locality: off Cullercoats, on the coast of Northumberland, England, United Kingdom
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits the lower reaches of large rivers, canals and is also found more rarely in lakes. It occurs on rocky, sandy and muddy substrates, feeding upon diatoms, algal debris and particulate organic matter (Mouthon 2007). This species spawns annually from March to June, and females lay eggs on the shells of their congeners. The species has a lifespan of 13-15 months (although lifespans of 16-17 months have been reported in the Netherlands) (Mouthon 2007). This species is known from depths of 0-6 m depth in Lake Lukomskoe (Belarus) (Matitsky and Samoilenko 2006).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lithoglyphus naticoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATGTGATCAGGGTTAGTTGGGACTGCTCTAAGACTTCTAATTCGAGCAGAACTAGGTCAACCTGGAGCTCTATTAGGGGAT---GACCAACTGTATAATGTAATTGTTACAGCACATGCATTCGTTATAATTTTCTTTTTAGTTATACCCATAATAATTGGAGGCTTCGGAAATTGATTAGTCCCATTAATATTAGGAGCACCCGATATAGCATTCCCACGTTTAAATAACATAAGTTTTTGATTACTTCCTCCAGCATTATTACTTTTACTTTCCTCAGCAGCCGTAGAAAGTGGTGCCGGAACTGGATGAACTGTCTATCCACCATTAGCTGGAAACCTGGCTCACGCCGGTGGTTCAGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGTGTATCCTCAATTTTAGGGGCCGTAAATTTTATTACAACAATTATTAATATACGATGACGTGGTATACAATTTGAGCGGCTACCTTTATTTGTTTGATCAGTAAAAATTACAGCAATTTTACTATTACTTTCATTACCAGTATTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATTTTAATACGGCTTTTTTTGATCCTGCAGGGGGGGGAGATCCAATTCTATAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lithoglyphus naticoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Van Damme, D.

Reviewer/s
Böhm, M. & Collen, B.

Contributor/s
Feher, Z. & Van Damme, D.

Justification
Lithoglyphus naticoides has been assessed as Least Concern. This species is geographically widespread throughout both its native and introduced European range. Whilst it is known that population abundance is currently declining on a local scale due to water pollution, global population trends are unknown. In parts of its European range, this species is listed on national Red List assessments, however as a non-native species it is not protected by law. This species is not considered to be severely impacted by the threat processes documented and is known to be resistant to declines in habitat quality.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is descibed as widespread, common and locally abundant (Arbačiauskas et al. 2008, Tyutin and Slynko 2010), however it is known to be undergoing large localised declines in Poland as a result of water pollution and river regulation (Glowaciński and Nowacki 2009). It has also disappeared from the Saône river at Lyon, France, since November 2004 (Mouthon 2007). This species has been recorded at densities of 466 individuals per m2 in France (Mouthon 2007) and 1,000 individuals per m2 in Lake Lukomskoe (Belarus) (Matitsky and Samoilemko 2006).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats to this species include water pollution and habitat degradation throughout its range; however, the species appears to be tolerant of poor environmental conditions and siltation (László et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed as Endangered on the Polish Red List, however as a non-native species it is not protected by law (Glowaciński and Nowacki 2009). It is also listed as Endangered on the list of threatened species of the Czech Republic (Farkač et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lithoglyphus naticoides

Lithoglyphus naticoides, common name the "gravel snail", is a species of small or minute freshwater snail with an operculum, an aquatic gastropod mollusk in the family Lithoglyphidae.

Lithoglyphus naticoides is the type species of the genus Lithoglyphus.[3]

Distribution[edit]

The distribution of Lithoglyphus naticoides in the Pliocene ranged from Western Europe to Western Siberia.[1] Its distribution subsequently shrank to the Ponto-Azov area during cooler eras.[1]

The distribution of this species is Pontic.[4] The native distribution includes only Black Sea rivers and the Danube up to Regensburg, from southeastern to central Europe.[5]

It has also artificially colonized other parts of Europe. After 1800 it was introduced to the Elbe and Rhine regions.[5]

After 1960 it has become almost extinct due to water pollution in central Europe.[5]

This snail is found in the following countries:

Western Europe:

Central Europe:

Eastern Europe:

Asia:

North America:

Description[edit]

This species is called "naticoides" because in shape and general appearance the shell and the operculum of this species is reminiscent of the shell and the operculum of the marine moon snails or Naticidae (for example, the Northern moon snail).

The shell is globular, light grey to greenish yellow or dark.[5] The shell has 4.5-5 whorls.[13] The last whorl is predominating.[5] Dimensions of the shell are 7-10 mm × 7-10 mm.[5] Or the width of the shell is 6.5-8 mm.[13] The height of the shell is 7-9 mm.[13]

Drawing of apertural view of a shell
Drawing of abapertural view of a shell
Outline drawing of a shell of Lithoglyphus naticoides and its operculum

The animal has a broad foot.[5] Males are often smaller than females.[5]

Ecology[edit]

It lives in rivers, lakes, channels and reservoirs.[1] In rivers, it lives at sites with low water currents, on solid muddy soils and at stones.[5] It requires high oxygen and calcium carbonate contents.[5] The population diversity reached up to 3.300 snails per m² according to Krause (1949).[14][13] It can live in salinity up to 3 ‰.[13]

Lithoglyphus naticoides feeds on diatomes and green alga.[13]

The life cycle of Lithoglyphus naticoides takes one year.[1] Reproduction of Lithoglyphus naticoides takes place mainly in July.[1] The morphology of the egg capsules has been described by Berezkina (2010).[15] The life span is 4–5 years.[13]

Parasites of Lithoglyphus naticoides include:

Human use[edit]

Perforated shells of Lithoglyphus naticoides were found in a Neolithic grave in Lower Austria as a head decoration.[19]

References[edit]

This article incorporates public domain text from the reference[5]

  1. ^ a b c d e f g h i j k l m n o Yakovlev V. A., Akhmetzyanova N. Sh. & Yakovleva A. V. (2010). "Distributional patterns and size-weight parameters of Lithoglyphus naticoides (Gastropoda: Hydrobiidae) in the upper reach of the Kuibyshev Reservoir". Russian Journal of Biological Invasions 1(4): 313-322. doi:10.1134/S2075111710040090.
  2. ^ Pfeiffer C. (1828). Naturgeschichte deutscher Land- und Süsswasser-Mollusken. Vol. 3 (1828): 84 pp. + 8 tables. Weimar. (Landes-Industrie-Comptoir). page 45, Taf. 8, Fig. 1, 2, 4.
  3. ^ "Species in genus Lithoglyphus". AnimalBase, accessed 22 May 2011.
  4. ^ (Slovak) Lisický M. J. (1991). Mollusca Slovenska [The Slovak molluscs]. VEDA vydavateľstvo Slovenskej akadémie vied, Bratislava, 344 pp.
  5. ^ a b c d e f g h i j k l "Species summary for Lithoglyphus naticoides". AnimalBase, last modified 24 February 2009, accessed 22 May 2011.
  6. ^ Mouthon J. (2007). "Lithoglyphus naticoides (Pfeiffer) (Gastropoda: Prosobranchia): distribution in France, population dynamics and life cycle in the Saône river at Lyon (France)". Annales de Limnologie - International Journal of Limnology 43(1): 53-59. doi:10.1051/limn/2007027.
  7. ^ (Czech) "Red List of the molluscs (Mollusca) of the Czech Republic". accessed 22 May 2011.
  8. ^ a b (Czech) Horsák M., Juřičková L., Beran L., Čejka T. & Dvořák L. (2010). "Komentovaný seznam měkkýšů zjištěných ve volné přírodě České a Slovenské republiky. [Annotated list of mollusc species recorded outdoors in the Czech and Slovak Republics]". Malacologica Bohemoslovaca, Suppl. 1: 1-37. PDF.
  9. ^ Glöer P. & Meier-Brook C. (2003). Süsswassermollusken. DJN, pp. 134, page 107, ISBN 3-923376-02-2
  10. ^ Piechocki A. "Lithoglyphus naticoides (C. Pfeiffer, 1828)". Polish Red Data Book of Animals, accessed 22 May 2011.
  11. ^ Mastitsky S. E. & Samoilenko V. M. (2006). "The gravel snail, Lithoglyphus naticoides (Gastropoda: Hydrobiidae), a new Ponto-Caspian species in Lake Lukomskoe (Belarus)". Aquatic Invasions 1(3): 161-170. doi:10.3391/ai.2006.1.3.11, PDF.
  12. ^ Yildirim M. Z., Koca S. B. & Kebapçi U. (2006). "Supplement to the Prosobranchia (Mollusca: Gastropoda) Fauna of Fresh and Brackish Waters of Turkey". Turkish Journal of Zoology 30: 197-204. PDF.
  13. ^ a b c d e f g Glöer P. (2002). Die Süßwassergastropoden Nord- und Mitteleuropas. Die Tierwelt Deutschlands, ConchBooks, Hackenheim, 326 pp., ISBN 3-925919-60-0.
  14. ^ (German) Krause H. (1949). "Untersuchungen zur Anatomie und Ökoelogie von Lithoglyphus naticoides (C. Pfeiffer)". Arch. Moll. 78: 103-148.
  15. ^ Berezkina G. V. (2010). "The morphology of egg capsules and syncapsules in freshwater Pectinibranchia (Mollusca: Gastropoda)". Inland Water Biology 3(1): 27-37. doi:10.1134/S1995082910010049.
  16. ^ Zhokhov A. E., Molodozhnikova N. M. & Pugacheva M. N. (2006). "Dispersal of invading trematodes Nicolla skrjabini (Iwanitzky, 1928) and Plagioporus skrjabini Kowal, 1951 (Trematoda: Opecoelidae) in the Volga". Russian Journal of Ecology 37(5): 363-365. doi:10.1134/S1067413606050110.
  17. ^ a b c Tyutin A. V. & Slynko Yu. V. (2010). "The first finding of the Black Sea snail Lithoglyphus naticoides (Gastropoda) and its associated species-specific trematoda in the Upper Volga basin". Russian Journal of Biological Invasions 1(1): 45-49. doi:10.1134/S2075111710010091.
  18. ^ (German) Odening K. (1970). "Der Entwicklungszyklus von Apophallus muehlingi (Trematoda: Opisthorchiida: Heterophyidae) in Berlin ". Parasitology Research 33(3): 194-210. doi:10.1007/BF00259490.
  19. ^ Harzhauser M., Lenneis E., & Neugebauer-Maresch C. (2007). "Freshwater gastropods as Neolithic adornment: size selectiveness and perforation morphology as a result of grinding techniques". Annalen des Naturhistorischen Museums in Wien 109A 73-85. PDF.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!