Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The trumpet worm is a bristle worm which protects itself in a conical-shaped tube which it makes itself from sand particles. The animal is named after its trumpet shape. It has golden brushes at the wide end of the tube, by its head. The worm burrows itself into soft bottoms. During easterly winds, you can find these worms on the beach.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 Lagis koreni is an infaunal segmented worm typically 2-3 cm in length and relatively thick. The body is divided into 3 distinct sections- a plate-like head, an abdomen with chaetae on the anterior 15 segments and a flattened, posterior appendage (scaphe) lacking chaetae. The head of Lagis koreni possesses an opercular plate for sealing its burrow, 2 pairs of tentacles plus numerous buccal cirri and 2 distinctive bundles of golden spines (paleae) used for burrowing. It is white in colour with pink iridescence, 2 pairs of red gills, and a red ventral vessel which is visible owing to its overall transparency. It lives head-down in a conical tube with a mucous extension.Adult densities may exceed 1000m², e.g. Eagle (1975), but numbers characteristically fluctuate widely from year to year, owing to variations in recruitment success and mortality. Lagis koreni often co-occurs with high densities of Abra alba (e.g. Eagle 1975). Lagis koreni is a significant food-source for commercially important demersal fish, especially dab and plaice, e.g. Macer (1967), Lockwood (1980) and Basimi & Grove (1985). The genus Lagis is often considered synonomous with Pectinaria, with the former sometimes considered a subgenus of the latter (e.g. Degraer et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1662 specimens in 1 taxon.
Water temperature and chemistry ranges based on 726 samples.

Environmental ranges
  Depth range (m): -1.16 - 380
  Temperature range (°C): 1.011 - 18.834
  Nitrate (umol/L): 0.267 - 16.868
  Salinity (PPS): 18.292 - 39.009
  Oxygen (ml/l): 5.240 - 7.340
  Phosphate (umol/l): 0.088 - 0.890
  Silicate (umol/l): 1.450 - 28.168

Graphical representation

Depth range (m): -1.16 - 380

Temperature range (°C): 1.011 - 18.834

Nitrate (umol/L): 0.267 - 16.868

Salinity (PPS): 18.292 - 39.009

Oxygen (ml/l): 5.240 - 7.340

Phosphate (umol/l): 0.088 - 0.890

Silicate (umol/l): 1.450 - 28.168
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Typically found in muddy sands or sandy muds, reaching highest densities in shallow inshore regions. Also widely distributed in the North Sea and English Channel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pectinaria koreni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 346 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAGGCTACTAATCCGAATTGAGCTTGGGCAACCCGGCTCTTTTTTAGGTAGA---GACCAACTGTACAATACGGTTGTAACTGCACATGCTTTTCTTATAATTTTCTTTCTTGTCATACCCGTCTTTATTGGTGGGTTTGGAAACTGACTTGTCCCATTAATACTTGCTGCTCCAGACATGGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTCCCTCCGGCCCTGATTCTTCTTCTGAGCTCCGCTGCAGTTGAAAAGGGCGTTGGTACAGGTTGAACAGTATACCCCCCCTTATCAAGAAACCTTGCACATGCGGGTCCATCTGTAGATTTGGCCATCTTTTCTCTCCACTTAGCCGGGATCTCATCTATTCTCGGAGCTATTAACTTTATTACTACCGTAATCAACATGCGGTCTAAAGGCCTTCGATTAGAACGAGTCCCTCTATTCGTGTGGGCAGTAAAGATTACTGCTATCCTTCTTCTTTTATCACTTCCTGTTTTAGCAGGAGCCATTACTATACTCCTAACTGACCGTAATTTAAACACCTCATTCTTCGATCCAGCAGGGGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pectinaria koreni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 346
Specimens with Barcodes: 346
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lagis koreni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lagis koreni

Lagis koreni, commonly known as the trumpet worm, is a species of marine polychaete worm found in European waters. It lives within a narrow conical tube made of grains of sand and shell fragments.[1]

Taxonomy[edit]

The trumpet worm inside and outside its tube.

In 1986, Holthe studied the family Pectinariidae and recognised four subgenera within the genus Pectinaria although he did not justify how he had come to this decision. In further reviews in 1973 and again in 1984, neither Long nor Wolf recognised these subgenera. In 2002, Pat Hutchings and Rachael Peart undertook a further review of the family. Among other findings, they determined that the Pectinaris subgenera should be given full species status. So the species that had been classified as Pectinaria koreni and later as Pectinaria (Lagis) koreni became Lagis koreni.[2]

Description[edit]

The trumpet worm is about 2.5 cm (1 in) long and relatively broad. The head has two pairs of tentacles and two bunches of gleaming golden spines which are used for digging. It also bears an operculum for sealing the tube in which it lives. The anterior fifteen body segments each bear chaetae or bristles, projecting laterally. These grow from a massive base and have six to eight rows of modified hooks and four rows of tiny teeth. The posterior segment is flattened and bears no chaetae. The animal is pale pink and iridescent, with two pairs of red gills and several red blood vessels visible beneath the surface.[3] It lives inside a long, narrow, conical tube composed of a single layer of grains of sand and shell fragments, skilfully cemented together like a mosaic [4] with a biomineralized adhesive substance secreted by specialized glands.[5]

Distribution and habitat[edit]

L. koreni is found in the seas bordering northwestern Europe including the Arctic Ocean, the Atlantic Ocean, the North Sea, the Mediterranean Sea and the Adriatic Sea. It is usually found buried in sand or silty sand in the neritic zone.[3]

Biology[edit]

The cone-shaped tube of L. koreni is open at both ends, with the narrow end level with or slightly above the surface of the sediment. The worm lives head down in this tube and collects sub-surface particles with its tentacles. In the process it excavates a "feeding cavern" and also forages with the tentacles in the surrounding substrate. It is even able to extend its tentacles as far as the interface between the sediment and the water. It passes the particles it collects via a ciliated groove in the tentacles to its mouth. It is a messy feeder and some particles fall off but these are trapped in the feeding cavern and can be consumed later. After processing the mineral grains and organic matter, unconsolidated faeces are ejected at the posterior, narrow end of the tube and are deposited on the sea floor. Some pseudo-faeces are similarly ejected, having been passed up between the worm and the tube. In some fine-grained sediment, the worm also forms a burrow up to the surface from its feeding cavern, actively keeping it open. Because the worm is constantly irrigating its tube by pumping water through it, suspended particles on the sea bed and in the water column are sometimes drawn into the feeding cavern and ingested.[6]

It has been found that foraminifera, ciliates and small copepods are the main diet of the worm. However it disproportionally favours larger particles including nematodes, crustaceans and larger foraminifera even though these are too big to be digested. These large particles also include faecal pellets of Abra alba, a bivalve mollusc, large numbers of which share the same habitat. Any nutritive benefit to the worm of this practice probably depends on the assimilation of organic molecules and microbes adhering to the surface of the pellet or soluble components from inside. The pellets themselves are ejected relatively unchanged.[6]

Sexual reproduction takes place in the summer. In a study off the coast of Wales, the worm released sperm in bundles into the water column in May and the ova matured at the same time. The larvae formed part of the zooplankton for a few weeks before undergoing metamorphosis and settling out in June.[7] The larvae began producing mucus tubes while still pelagic and on settling, started cementing sand grains on to the opening of the tubes.[8] The young worms grew quickly until the onset of winter, when growth ceased.[7]

Ecology[edit]

The trumpet worm is sometimes found at a density of a thousand individuals per square metre, but numbers fluctuate greatly. Species associated with the trumpet worm in a community include the white furrow shell (Abra alba), the razor shell (Phaxas pellucidus), the bivalve (Mysella bidentata), the brittle star (Ophiura ophiura) and various polychaete worms. It has been found in studies of Liverpool Bay that in areas where the sediment has been disturbed by dredging and more deposition has occurred, Lagis koreni and Phaxas pellucidus often come to dominate the community.[9] Also in these studies, the community was shown to be associated with different habitats.[9]

The trumpet worm is often eaten by bottom-feeding fish including juvenile common dabs and plaice.[3]

References[edit]

  1. ^ a b Lagis koreni Malmgren, 1866. World Register of Marine Species. Retrieved August 8, 2011.
  2. ^ A Review of the Genera of Pectinariidae (Polychaeta) Together with a Description of the Australian Fauna. Australian Museums. Retrieved August 8, 2011.
  3. ^ a b c A bristleworm - Lagis koreni - General information. Marine Life Information Network. Retrieved August 8, 2011.
  4. ^ Barrett, J. & C. M. Yonge (1958) Collins Pocket Guide to the Sea Shore. Collins, London
  5. ^ Inter- and intraspecific variability in the chemical composition of the mineral phase of cements from several tube-building polychaetes. Retrieved August 8, 2011.
  6. ^ a b Sediment processing and selective feeding by Pectinaria koreni (Polychaeta: Pectinariidae). Retrieved August 8, 2011.
  7. ^ a b Life history and productivity of Pectinaria koreni Malmgren (polychaeta). Retrieved August 8, 2011.
  8. ^ Coastal marine zooplankton: a practical manual for students. Retrieved August 8, 2011.
  9. ^ a b "Lagis koreni and Phaxas pellucidus in circalittoral sandy mud". Joint Nature Conservation Council. Retrieved August 8, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!