Overview

Distribution

Gulf of St. Lawrence (unspecified region), northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: Eastern Bradelle Valley), downstream part of Middle St. Lawrence estuary, Magdalen Islands (from Eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), and the Laurentian Channel (bathyal zone)(=Honguedo Strait); Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 741 samples.

Environmental ranges
  Depth range (m): 0 - 3536
  Temperature range (°C): -1.191 - 23.658
  Nitrate (umol/L): 0.289 - 31.717
  Salinity (PPS): 32.851 - 35.556
  Oxygen (ml/l): 3.028 - 7.732
  Phosphate (umol/l): 0.132 - 2.182
  Silicate (umol/l): 1.010 - 51.234

Graphical representation

Depth range (m): 0 - 3536

Temperature range (°C): -1.191 - 23.658

Nitrate (umol/L): 0.289 - 31.717

Salinity (PPS): 32.851 - 35.556

Oxygen (ml/l): 3.028 - 7.732

Phosphate (umol/l): 0.132 - 2.182

Silicate (umol/l): 1.010 - 51.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ophelina acuminata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ophelina acuminata CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACCCTTTACTTCATTTTCGGAGCATGAGGAGGCCTTCTTGGCACCTCCATAAGTCTCCTTATTCGAGCTGAGCTTGGACAACCTGGATCCCTTCTAGGGAGGGACCAGCTCTATAACACTATCGTTACCGCTCACGCTTTTCTAATAATTTTCTTTCTTGTTATACCAGTATTTATTGGAGGCTTTGGAAATTGACTTATCCCCCTAATACTAGGGGCCCCAGATATGGCATTTCCCCGGCTAAACAATATAAGATTCTGACTTCTCCCCCCGTCTCTCATTCTTCTAGTTTCTTCCGCAGCTGTAGAAAAAGGAGTTGGGACAGGATGAACCGTCTATCCCCCTCTCTCTAGAAACCTAGCCCACGCTGGTCCCTCTGTAGATCTAGCAATTTTCTCTCTACACCTAGCTGGAATTTCATCAATTCTAGGCTCTCTAAACTTTATCACTACTGTAATCAATATACGGTGAAAAGGACTTCGTCTTGAACGCATTCCCCTCTTTGTATGAGCCGCTGTAATTACAACTGTTCTTCTTCTCCTATCTCTACCAGTACTTGCTGGTGCAATTACTATACTTCTTACTGATCGAAACCTAAATACTGCATTCTTTGATCCTGCGGGTGGTGGAGACCCTGTTCTTTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ophelina acuminata CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!