Overview

Distribution

downstream part of middle St. Lawrence estuary; lower St. Lawrence estuary; Cobscook Bay to Cape Hatteras
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Nicolea simplex Verrill
Catalog Number: USNM 9262
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Verrill
Year Collected: 1871
Locality: Vineyard Sound, Massachusetts, United States, North Atlantic Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0 - 1330
  Temperature range (°C): -0.769 - 11.513
  Nitrate (umol/L): 3.010 - 14.904
  Salinity (PPS): 31.893 - 35.253
  Oxygen (ml/l): 6.095 - 6.845
  Phosphate (umol/l): 0.408 - 1.065
  Silicate (umol/l): 2.052 - 15.658

Graphical representation

Depth range (m): 0 - 1330

Temperature range (°C): -0.769 - 11.513

Nitrate (umol/L): 3.010 - 14.904

Salinity (PPS): 31.893 - 35.253

Oxygen (ml/l): 6.095 - 6.845

Phosphate (umol/l): 0.408 - 1.065

Silicate (umol/l): 2.052 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nicolea zostericola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGACACTCTACTTCTTATTTGGGGTATGAGGGGGCCTACTTGGTACATCCATAAGACTTCTTATTCGTATTGAGTTAGGCCAACCCGGCTCATTTCTTGGTAGTGACCAACTATACAACACTGTTGTCACTGCCCATGCATTTCTTATAATCTTTTTTCTTGTCATACCAATCTTAATTGGTGGATTCGGAAACTGACTCCTCCCATTAATACTAGGGGCCCCTGATATGGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCTGCATTAATACTCCTTCTTAGATCGGCAGCGGTTGAAAAAGGAGCAGGGACTGGCTGAACAGTCTACCCCCCTCTATCCAGAAACCTCGCACATGCCGGCCCTTCTGTAGATCTAGCTATTTTCTCCCTTCACCTGGCAGGTATTTCATCTATCTTAGGTGCTATTAATTTTATTACAACAGTAGCTAACATACGCTGAAAAGGCCTACGACTAGAACGTCTACCCCTTTTTGTTTGAGCAGTCAATATTACTGTAGTTCTACTTCTTCTCTCACTTCCAGTTTTAGCAGGCGCCATCACAATACTACTTACAGACCGTAACGTAAACACTTCTTTCTTTGACCCTGCCGGAGGGGGCGACCCCATCCTATACCAACACTTATTCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nicolea zostericola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!