Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

2 subspecies

Taxonomic history

, figs, 32, 33 (w.q.) FINLAND.
Nylander, 1849 PDF: 31 (m.); Formicidae). Experientia (Basel) 21:323-325. [1965-06-15]">Hauschteck, 1965 PDF: 325 (k.).
Senior synonym of Myrmica alpestris, Myrmica angustifrons: Seifert, 1988b: 38; of Myrmica arduennae: Donisthorpe, 1915f: 134; Bernard, 1967a PDF: 122; Boven, 1977: 119; Seifert, 1988b: 38; of Myrmica burtshakabramovitshi: Arnol'di, 1970b PDF: 1842; of Myrmica denticornis: Mayr, 1861 PDF: 63; Seifert, 1988b: 38; of Myrmica foreli: Bernard, 1967a PDF: 122; Seifert, 1988b: 38; of Myrmica kieviensis: Arnol'di, 1970b PDF: 1842; of Myrmica lissahorensis: Bernard, 1967a PDF: 122; Seifert, 1988b: 38; of Myrmica starki: Arnol'di, 1970b PDF: 1842; Seifert, 1988b: 38; of Myrmica brunescens: Myrmica (Hymenoptera, Formicidae) from central and eastern Palearctic. [In Russian.]. Zoologicheskii Zhurnal 73(11):81-92. [1994-11]">Radchenko, 1994i PDF: 87.
Material of the nomen nudum Myrmica nodicornis referred here by Donisthorpe, 1915f: 134.
See also: Radchenko, 2007: 29; Radchenko & Elmes, 2010: 185.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Various habitats
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

8. Myrmica lobicornis HNS . Pl. XII. fig. 12. B.M.

Myrmica lobicornis HNS , Nyl. Adno. Mon. Form. Bor. Eur. 932. 4; Addit. Adno. Mon. Form. Bor. Eur. 1052. 21; Addit. ait. 31;

Form. Fr. et d'Alger. 82. 7-

Foerst. Hym. Stud. Form. 69.

Schenck, Beschr. Nass. Ameis. 82.

Mayr. Form. Austr. 140. 7.

Myrmica denticornis, Curtis HNS , Trans. Linn. Soc. xxi. 215. 7. t. 23. f. 18, 19.

Smith, Brit. Form. 120. 5.

Hab. Britain; France; Germany; Hungary; Italy; Finland.

We have compared specimens of this species from Dr, Nylander with others from Mr. Curtis, and they are certainly identical.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 116-116, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

4. Myrmica lobicornis Nylander HNS , 1846 Figs. 32,41,45,62.

Myrmica lobicornis Nylander HNS , 1846:932.

Figs. 66-68. Petiole and postpetiole of Myrmica HNS -males. - 66: sabuleti Mein HNS .; 67: scabrinodis Nyl HNS .; 68: hirsuta Elmes HNS . Scale: 1 mm. (68 redrawn from Elmes, 1978).

Worker . Bicoloured reddish brown with head and gaster characteristically darker. Upright tooth-like process at the bend of the antennal scape, frequently very large in Scandinavian samples but very variable in size over its whole geographic range. Frons about 1/3 head width. Petiole high with anterior and dorsal surfaces meeting at a right angle. Postpetiole broadly oval from above. Head Index: 87.8; Frons Index: 30.8; Frontal Laminae Index: 65.5. Length: 4.0-5.0 mm.

Queen. As worker, with head and scutum normally darker. Length: 5.0-5.5 mm.

Male. Black, legs and articulations paler. Antennal scape as long as 5-6 following segments, angled near base. Length: 5.0-5.5 mm.

Distribution. Locally common throughout Denmark, Fennoscandia and the British Isles but excluding Ireland. - Range: Portugal to Central Russia, Appenines to Arctic Norway.

Biology. It is a mountain species in Central and S. Europe but in the north occurs equally on lowland heath and in open woodland. Although widely distributed it is not abundant and occurs in isolated single queen colonies nesting in peat or under stones. It is commonly found as single foraging workers and is one of the least aggressive members of the genus.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 51-52, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

4. M. lobicornis HNS .

Operaria: obscure rubida sparse flavido-pilosula, capite et abdomine fusco-nigrescentibus, maudibulis anteanisque rufescentibus; capite, thorace et petiolo longitudiualiter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversim posito; metanoti spinis longis.

Femina: fusca sparse flavido-pilosula; mandibulis apice, antennis et pedibus pallide rufescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversus posito; metanoti spinis longiusculis; alis hyalinis nervis et stigmate dilute cinerco-pallescentibus.

Hab. per totam saltem Fenniam sat frequens. Nidulatur in terra locis arenosis vel graminosis. Feminam circa medium m. Augusti rarius in Ostrobottnia boreali deprehendi. Marem hucusque ignoro.

[[ worker ]]. Long. 1 2 / 3 - 2 lin. Similis praecedenti, at minus forte robusta, colore jam et scapi formatione alia distincta. Mandibulae pallide ferrugineae apice summo luscescente. Area frontalis conspicua. Lamina frontalis ut in praecedente, marginibus infra utrinque dilatatis parum reflexis. Antennae obscurius, quam mandibulae, rulae; scapus lobo compresso antice parum concaviusculo, formas laminae subsemirotundatas, transversim supra flexuram prope basin posito. (Est hic lobus paullo major, compressior, neque oblique positus, sicut in praecedente). Caput lateribus reticulatim rugosum. Thorax et petiolus longitudinaliter crasse scabri, sordide fuscescenti-rubidi; nodi sculptura rugosa crassa inaequali longitudinali. Pedes sordide ferrugineo-pallescentes. Abdomen apice obsolete pallescens.

[[ queen ]]. Long. 2 1 / 2 lin. Similis quoque feminae praecedentis, sed colore et scapo aliter formato mox distincta. Mandibulas apicibus late pallide-rufescentibus. Area triangularis, lamina frontalis et scapus antennarum ut in [[ worker ]]. Thorax fuscus, pronoto antice inaequaliter crasse rugoso, ceteroquin longiludinaliter crasse striatus, infra et apice obsolete rubido-rufescens. Nodi fusci infra rubido-rufescentes, crasse sublongitudinaliter rugosi. Alae ut in prsecedente, sed fere adhuc obsoletius colore cinereo-pallescente dilutissimo: tinctae; anticae long. 2 1 / 3 lin. Pedes nitidi ferrugineo-pallescentes longe flavo pubescentes. Abdomen apice obscure fusco-rufescente.

  • Nylander, W. (1846): Adnotationes in monographiam formicarum borealium Europae. Acta Societatis Scientiarum Fennicae 2, 875-944: 932-933, URL:http://antbase.org/ants/publications/4277/4277.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mostly Alpine & Dinaric SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Nylander, W., 1846:
 Operaria: obscure rubida sparse flavido-pilosula, capite et abdomine fusco-nigrescentibus, maudibulis anteanisque rufescentibus; capite, thorace et petiolo longitudiualiter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversim posito; metanoti spinis longis.
 Femina: fusca sparse flavido-pilosula; mandibulis apice, antennis et pedibus pallide rufescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversus posito; metanoti spinis longiusculis; alis hyalinis nervis et stigmate dilute cinerco-pallescentibus.
 Hab. per totam saltem Fenniam sat frequens. Nidulatur in terra locis arenosis vel graminosis. Feminam circa medium m. Augusti rarius in Ostrobottnia boreali deprehendi. Marem hucusque ignoro.
 [[ worker ]]. Long. 1 2 / 3 - 2 lin. Similis praecedenti, at minus forte robusta, colore jam et scapi formatione alia distincta. Mandibulae pallide ferrugineae apice summo luscescente. Area frontalis conspicua. Lamina frontalis ut in praecedente, marginibus infra utrinque dilatatis parum reflexis. Antennae obscurius, quam mandibulae, rulae; scapus lobo compresso antice parum concaviusculo, formas laminae subsemirotundatas, transversim supra flexuram prope basin posito. (Est hic lobus paullo major, compressior, neque oblique positus, sicut in praecedente). Caput lateribus reticulatim rugosum. Thorax et petiolus longitudinaliter crasse scabri, sordide fuscescenti-rubidi; nodi sculptura rugosa crassa inaequali longitudinali. Pedes sordide ferrugineo-pallescentes. Abdomen apice obsolete pallescens.
 [[ queen ]]. Long. 2 1 / 2 lin. Similis quoque feminae praecedentis, sed colore et scapo aliter formato mox distincta. Mandibulas apicibus late pallide-rufescentibus. Area triangularis, lamina frontalis et scapus antennarum ut in [[ worker ]]. Thorax fuscus, pronoto antice inaequaliter crasse rugoso, ceteroquin longiludinaliter crasse striatus, infra et apice obsolete rubido-rufescens. Nodi fusci infra rubido-rufescentes, crasse sublongitudinaliter rugosi. Alae ut in prsecedente, sed fere adhuc obsoletius colore cinereo-pallescente dilutissimo: tinctae; anticae long. 2 1 / 3 lin. Pedes nitidi ferrugineo-pallescentes longe flavo pubescentes. Abdomen apice obscure fusco-rufescente.
 

Smith, F.:
  Myrmica lobicornis , Nyl. Adno. Mon. Form. Bor. Eur. 932. 4; Addit. Adno. Mon. Form. Bor. Eur. 1052. 21; Addit. ait. 31;
  Form. Fr. et d'Alger. 82. 7-
  Foerst. Hym. Stud. Form. 69.
  Schenck, Beschr. Nass. Ameis. 82.
  Mayr. Form. Austr. 140. 7.
  Myrmica denticornis, Curtis , Trans. Linn. Soc. xxi. 215. 7. t. 23. f. 18, 19.
  Smith, Brit. Form. 120. 5.
  Hab. Britain; France; Germany; Hungary; Italy; Finland.
  We have compared specimens of this species from Dr, Nylander with others from Mr. Curtis, and they are certainly identical.
 

Förster, A.:
  Nyl. Adn. p. 932, 4.
  Operaria: Obscure rubida, sparse flavido-pilosula, capite et abdomine fusco-nigrescentibus; antennis 12-articulatis, scapo ad basin geniculatim flexo, supra lobo transversim posito; capite, thorace nodisque segmenti primi longitudinaliter striatim. profunde rugosis; metanoti spinis longis. Long. 2 lin.
  Femina: Rubida, sparse flavido-pilosula, capite, thorace plus minus et abdomine (segm. primo exc.) supra fuseis, mesopleuris cum mesQsterho fusco-maculatis; antennis 12-articulatis, scapo ad basin geniculatim flexo, supra lobo transversim posito; capite, thorace nodisque segmenti primi longitudinaliter striatiitf profunde rugosis;"metarioti spinis longiusculis (Alis hyalinis, nervis et stigmate dilute cinereo-pallescentibus. (Nyl.) Long. 2 2/3 lin.
  Der Arbeiter ist auf dem Kopf und Hinterleib dunkler gefärbt als die vorhergehenden Arten, die Stirn mit gröberen Längsrunzeln bedeckt, welche auch hinter der Fühlerwurzel und den Netzaugen sehr deutlich sind, obgleich sie hier schon etwas gebogen und mit mehr oder weniger deutlichen Querrunzeln versehen, auftreten. Die Stirnrunzeln setzen sich durch das Stirnfeld in den Clypeus fort, auf dem letzteren sind sie ausnehmend scharf. Die Stirnlamellen mit einem ziemlich scharf aufgebogenen Rand, jedoch nicht so atark.tri bei scabrinodis. Die Mandibeln sind roth, ziemlich grob längsrunzlig und an der Spitze nicht besonders deutlich punktirt. Die Fühler roth, 12-gliedrig, der Schaft an der Basis winklig gebrechen und in der kniefoermigen Biegung mit einem halbkreisförmigen , scharf und breit aufgeworfenen Rande versehen, der sich gleichsam lappenförmig erweitert An dieser auffallenden Bildung des Schaftes wird diese Nylandersche Art sehr leicht erkannt. Die übrigen Glieder des Fühlers zeigen die gewoehnliche Bildung der drei vorhergehenden Arten. Der ganze Mittelleib oben und die Brustseiten sehr grob längsrunzlig , die Runzeln etwas gekrümmt ; die abschüssige Stelle des Metanotum's allein völlig glatt, die Dornen lang und spitz. Die Knoten des lsten Segments grobrunzlig, der hintere oben in der Mitte fast etwas glatt, der vordere auf der Unterseite mit einem stumpfen Zähnchen . Der ganze Körper ist wie bei den vorhergehenden Arten mit gelblichen Borstenhaaren besetzt.
  Das Weibchen gleicht in der Färbung dem Arbeiter, nur ist an dem mir vorliegenden Stück die rothe Farbe etwas heller und die Farbe des Kopfes und Hinterleibs noch etwas dunkler; der Hinterrand des Pronotum's, 3 Flecken des Mesonotum's, die Spitze des Schildchens und das Frenum ebenfalls schwarzbraun, auch die Mittelbrustseiten und die Mittelbrust haben beiderseits einen schwarzen Flecken. Die Bildung des Kopfes ist ganz wie bei dem Arbeiter, die Mandibeln noch etwas gröber längsrunzlig und an der Spitze deutlich grob punktirt. Die Fühler haben den Schaft an der Basis ebenfalls winklig gebrochen, aber der scharfe aufgebogene Rand ist noch breiter und mehr in die Augen fallend als bei dem Arbeiter, dagegen sind die Runzeln auf der Oberfläche des Kopfes nicht ganz so scharf. Die Nebenaugen deutlich. Der ganze Mittelleib und auch die Brustselten scharf längsrunzlig , die Runzeln zwar nicht so grob, aber mehr grade und regelmäßiger als bei dem Arbeiter. Die abschüssige Stelle des Metanotum's völlig glatt, die Dornen lang, ein wenig gebogen. Die Flügel nach Nylander wie bei scabrinodis, aber nicht so deutlich bräunlich , sondern etwas heller, blaß oder schmutzig gelblich. Die Knoten des lsten Segments wie bei dem Arbeiter, die Behaarung ebenfalls ganz übereinstimmend mit dem letzteren.
  Von dieser ebenso charakteristischen als seltnen Art habe ich bis jetzt in der Nähe von Aachen nur einen Arbeiter und ein ungeflügeltes Weibchen entdecken können . Das Männchen kenne ich nicht, es ist auch Nylander unbekannt geblieben.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 8): Bulgaria ( Agosti and Collingwood 1987a , Seifert 1988a : entire Europe excluding Italy and Greece); Central Stara Planina Mts: Karlovo Balkan ( Atanassov 1936 , Atanassov and Dlusskij 1992 ); Vitosha Mt. ( Atanassov 1936 , 1952 , Atanassov and Dlusskij 1992 ); Plana Mt.: Plana vill., Tsiganka peak (Pasarel vill.) ( Vagalinski and Lapeva-Gjonova in press ); Osogovska Planina Mt., Belasitsa Mt. ( Atanassov and Dlusskij 1992 ); Rila Mt.: Elenin peak, Rilska river valley ( Forel 1892 , Atanassov and Dlusskij 1992 ); Pirin Mt. ( Atanassov and Dlusskij 1992 ); Slavianka Mt.: Alibotush reserve ( Antonova 2009 ); Rhodopi Mts ( Atanassov and Dlusskij 1992 ); Western Rhodopi Mts: Peshtera ( Lapeva-Gjonova in press (a) ).

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Operaria: obscure rubida sparse flavido-pilosula, capite et abdomine fusco-nigrescentibus, maudibulis anteanisque rufescentibus; capite, thorace et petiolo longitudiualiter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversim posito; metanoti spinis longis.

 

Femina: fusca sparse flavido-pilosula; mandibulis apice, antennis et pedibus pallide rufescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin curvato, supra lobo transversus posito; metanoti spinis longiusculis; alis hyalinis nervis et stigmate dilute cinerco-pallescentibus.

 

Hab. per totam saltem Fenniam sat frequens. Nidulatur in terra locis arenosis vel graminosis. Feminam circa medium m. Augusti rarius in Ostrobottnia boreali deprehendi. Marem hucusque ignoro.

 

[[ worker ]]. Long. 1 2 / 3 - 2 lin. Similis praecedenti, at minus forte robusta, colore jam et scapi formatione alia distincta. Mandibulae pallide ferrugineae apice summo luscescente. Area frontalis conspicua. Lamina frontalis ut in praecedente, marginibus infra utrinque dilatatis parum reflexis. Antennae obscurius, quam mandibulae, rulae; scapus lobo compresso antice parum concaviusculo, formas laminae subsemirotundatas, transversim supra flexuram prope basin posito. (Est hic lobus paullo major, compressior, neque oblique positus, sicut in praecedente). Caput lateribus reticulatim rugosum. Thorax et petiolus longitudinaliter crasse scabri, sordide fuscescenti-rubidi; nodi sculptura rugosa crassa inaequali longitudinali. Pedes sordide ferrugineo-pallescentes. Abdomen apice obsolete pallescens.

 

[[ queen ]]. Long. 2 1 / 2 lin. Similis quoque feminae praecedentis, sed colore et scapo aliter formato mox distincta. Mandibulas apicibus late pallide-rufescentibus. Area triangularis, lamina frontalis et scapus antennarum ut in [[ worker ]]. Thorax fuscus, pronoto antice inaequaliter crasse rugoso, ceteroquin longiludinaliter crasse striatus, infra et apice obsolete rubido-rufescens. Nodi fusci infra rubido-rufescentes, crasse sublongitudinaliter rugosi. Alae ut in prsecedente, sed fere adhuc obsoletius colore cinereo-pallescente dilutissimo: tinctae; anticae long. 2 1 / 3 lin. Pedes nitidi ferrugineo-pallescentes longe flavo pubescentes. Abdomen apice obscure fusco-rufescente.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmica lobicornis , Nyl. Adno. Mon. Form. Bor. Eur. 932. 4; Addit. Adno. Mon. Form. Bor. Eur. 1052. 21; Addit. ait. 31;

 

Form. Fr. et d'Alger. 82. 7-

 

Foerst. Hym. Stud. Form. 69.

 

Schenck, Beschr. Nass. Ameis. 82.

 

Mayr. Form. Austr. 140. 7.

 

Myrmica denticornis, Curtis , Trans. Linn. Soc. xxi. 215. 7. t. 23. f. 18, 19.

 

Smith, Brit. Form. 120. 5.

 

Hab. Britain; France; Germany; Hungary; Italy; Finland.

 

We have compared specimens of this species from Dr, Nylander with others from Mr. Curtis, and they are certainly identical.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nyl. Adn. p. 932, 4.

 

Operaria: Obscure rubida, sparse flavido-pilosula, capite et abdomine fusco-nigrescentibus; antennis 12-articulatis, scapo ad basin geniculatim flexo, supra lobo transversim posito; capite, thorace nodisque segmenti primi longitudinaliter striatim. profunde rugosis; metanoti spinis longis. Long. 2 lin.

 

Femina: Rubida, sparse flavido-pilosula, capite, thorace plus minus et abdomine (segm. primo exc.) supra fuseis, mesopleuris cum mesQsterho fusco-maculatis; antennis 12-articulatis, scapo ad basin geniculatim flexo, supra lobo transversim posito; capite, thorace nodisque segmenti primi longitudinaliter striatiitf profunde rugosis;"metarioti spinis longiusculis (Alis hyalinis, nervis et stigmate dilute cinereo-pallescentibus. (Nyl.) Long. 2 2/3 lin.

 

Der Arbeiter ist auf dem Kopf und Hinterleib dunkler gefärbt als die vorhergehenden Arten, die Stirn mit gröberenLängsrunzeln bedeckt, welche auch hinter der Fühlerwurzel und den Netzaugen sehr deutlich sind, obgleich sie hier schon etwas gebogen und mit mehr oder weniger deutlichen Querrunzeln versehen, auftreten. Die Stirnrunzeln setzen sich durch das Stirnfeld in den Clypeus fort, auf dem letzteren sind sie ausnehmend scharf. Die Stirnlamellen mit einem ziemlich scharf aufgebogenen Rand, jedoch nicht so atark.tri bei scabrinodis. Die Mandibeln sind roth, ziemlich grob längsrunzlig und an der Spitze nicht besonders deutlich punktirt. Die Fühler roth, 12-gliedrig, der Schaft an der Basis winklig gebrechen und in der kniefoermigen Biegung mit einem halbkreisförmigen , scharf und breit aufgeworfenen Rande versehen, der sich gleichsam lappenförmig erweitert An dieser auffallenden Bildung des Schaftes wird diese Nylandersche Art sehr leicht erkannt. Die übrigen Glieder des Fühlers zeigen die gewoehnliche Bildung der drei vorhergehenden Arten. Der ganze Mittelleib oben und die Brustseiten sehr grob längsrunzlig , die Runzeln etwas gekrümmt ; die abschüssige Stelle des Metanotum's allein völlig glatt, die Dornen lang und spitz. Die Knoten des lsten Segments grobrunzlig, der hintere oben in der Mitte fast etwas glatt, der vordere auf der Unterseite mit einem stumpfen Zähnchen . Der ganze Körper ist wie bei den vorhergehenden Arten mit gelblichen Borstenhaaren besetzt.

 

Das Weibchen gleicht in der Färbung dem Arbeiter, nur ist an dem mir vorliegenden Stück die rothe Farbe etwas heller und die Farbe des Kopfes und Hinterleibs noch etwas dunkler; der Hinterrand des Pronotum's, 3 Flecken des Mesonotum's, die Spitze des Schildchens und das Frenum ebenfalls schwarzbraun, auch die Mittelbrustseiten und die Mittelbrust haben beiderseits einen schwarzen Flecken. Die Bildung des Kopfes ist ganz wie bei dem Arbeiter, die Mandibeln noch etwas gröberlängsrunzlig und an der Spitze deutlich grob punktirt. Die Fühler haben den Schaft an der Basis ebenfalls winklig gebrochen, aber der scharfe aufgebogene Rand ist noch breiter und mehr in die Augen fallend als bei dem Arbeiter, dagegen sind die Runzeln auf der Oberfläche des Kopfes nicht ganz so scharf. Die Nebenaugen deutlich. Der ganze Mittelleib und auch die Brustselten scharf längsrunzlig , die Runzeln zwar nicht so grob, aber mehr grade und regelmäßiger als bei dem Arbeiter. Die abschüssige Stelle des Metanotum's völlig glatt, die Dornen lang, ein wenig gebogen. Die Flügel nach Nylander wie bei scabrinodis, aber nicht so deutlich bräunlich , sondern etwas heller, blaß oder schmutzig gelblich. Die Knoten des lsten Segments wie bei dem Arbeiter, die Behaarung ebenfalls ganz übereinstimmend mit dem letzteren.

 

Von dieser ebenso charakteristischen als seltnen Art habe ich bis jetzt in der Nähe von Aachen nur einen Arbeiter und ein ungeflügeltes Weibchen entdecken können . Das Männchen kenne ich nicht, es ist auch Nylander unbekannt geblieben.

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myrmica lobicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAATTATTCGCTTAGAACTAGGATCTTGTAATTCACTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACCAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTCATAATCGGAGGTTTTGGAAATTTCTTAGTTCCTTTAATA---TTAGGATCTCCTGATATAGCCTACCCTCGTATAAATAATATAAGATTTTGACTCCTTCCCCCCTCAATCATATTATTAATATTAAGAAATTTTCTAAGGAATGGTGTGGGAACTGGTTGAACAATTTACCCCCCATTAGCTTCTAATATTTTCCATAGCGGCCCCTCAATTGATATATCA---ATCTTTTCTTTACATATAGCAGGAATATCTTCAATCCTCGGAGCAATCAATTTTATCTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCTTTAATAGTGTGATCAATTATAATTACAGCAGTACTTCTTCTTTTATCTCTTCCAGTATTAGCAGGA---GCAATTACTATACTTCTCACAGATCGAAATCTAAATACTTCATTTTTTGACCCCTCAGGAGGGGGAGATCCAATTTTATACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATCTTACCAGGATTTGGCCTAATTTCCCATATTATTATAAGAGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTTGGAATAATTTATGCTATAATTGCAATTGGATTTTTAGGATTTATTGTTTGAGCACATCATATATTTACAATTGGATTAGATGTAGATACCCGAGCTTACTTTACATCAGCAACTATAATTATTGCTATTCCTACAGGTATTAAAATTTTTAGATGAATCTCC---ACTCTTCATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica lobicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myrmica lobicornis

Myrmica lobicornis is an ant species distributed through the planes of North Europe and the mountains of Central and Southern Europe. It is also found in the forest zone of East Europe, the Caucasus, West Siberia, North-East Kazakhstan, East Siberia, and Mongolia stretching until Transbaikalia in the East. It inhabits coniferous or mixed woodlands, occasionally also meadows. It mostly nests in the ground, forms monogynous colonies containing a few hundred workers.[1][2]

References[edit]

  1. ^ Csősz S, Markó B, Gallé L (2011). "The myrmecofauna (Hymenoptera: Formicidae) of Hungary: an updated checklist". North-Western Journal of Zoology 7: 55–62. 
  2. ^ Czekes Z et al. (2012). "The genus Myrmica Latreille, 1804 (Hymenoptera: Formicidae) in Romania: distribution of species and key for their identification". Entomologica romanica 17: 29–50. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!