Molecular Biology and Genetics

Molecular Biology

Barcode data: Cypraea pantherina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCAGGTTTAGTTGGAACGGCCCTTAGTTTATTAATTCGAGCAGAATTAGGACAACCAGGGGCCTTATTGGGGGAT---GACCAGTTATATAATGTAATCGTAACGGCTCATGCATTTGTTATAATCTTCTTTTTGGTTATGCCCATAATAATTGGTGGATTTGGAAATTGACTTGTTCCCTTAATGTTAGGAGCTCCAGATATAGCTTTCCCACGTTTAAATAATATAAGTTTCTGGCTTCTTCCTCCTGCTCTTCTTCTCTTACTTTCTTCAGCAGCTGTTGAAAGAGGAGTTGGGACAGGTTGAACAGTGTATCCTCCTTTGGCAGGAAATCTTGCTCATGCTGGAGGATCAGTAGACCTTGCAATTTTTTCACTACACCTTGCTGGTGTGTCATCTATTTTAGGTGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGAATACAATTTGAGCGGCTCCCATTATTTGTCTGGTCAGTAAAAATTACTGCAGTTTTACTATTACTTTCTTTGCCTGTTTTGGCCGGAGCAATTACAATATTACTAACAGACCGAAATTTTAATACGGCCTTCTTTGATCCTGCAGGAGGGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cypraea pantherina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cypraea pantherina

Cypraea pantherina, common name the panther cowry, is a species of large tropical sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

The panther cowry is one of only two species currently included in the genus Cypraea (the second species is Cypraea tigris, Linnaeus, 1758), as all other species previously belonging to the genus Cypraea have been reassigned to other genera within the family Cypraeidae.

Shells of Cypraea pantherina have been found in tombs in the Rhine valley dated to 6 BCE. [1] Furthermore, shells of this species and the related Cypraea tigris have been unearthed at Pompeii, the ancient Roman city near Naples, Italy, where these shells may have been used as an ornament.

Contents

Description

This quite common species looks very similar to Cypraea tigris, but its shell is more slender and lighter. The shells of Cypraea pantherina reach on average 57–65 millimetres (2.2–2.6 in) of length, with a minimum size of 37 millimetres (1.5 in) and a maximum size of 118 millimetres (4.6 in). The shape of these shells is roughly elongate-pyriform. They are quite heavy for their size. The dorsum surface is smooth and shiny, usually whitish or pale brown, densely covered with dark brown circular spots. A blurred longitudinal reddish line runs along the midline where the two halves of the mantle meet in life.

However, the basic colors of the shell are very variable, as they range from melanic or chestnut red to albino. The lower margins are rounded and the ventral side is white or whitish, with several long and fine teeth along the aperture.

In live animals the mantle is thin and quite transparent, with many longitudinal slight lines and numerous long and white sensorial papillae. The lateral extensions of the mantle may cover the shell completely, meeting at the midline of the dorsum. The mantle can also be withdrawn into the shell opening when the cowry is threatened.

A shell of Cypraea pantherina from Sudan, lateral view, anterior end towards the right
Dorsal view of shells of Cypraea pantherina from Sudan, anterior end towards the right

Distribution

The panther cowry is endemic to the Red Sea (off Egypt and Sudan), Gulf of Aqaba, Dahlak Islands and Gulf of Aden). Its range does not overlap with Cypraea tigris. This species has also become established in the Mediterranean Sea (Lampedusa Island and Malta), probably having entered through the Suez Canal. [2]

Habitat

Cypraea pantherina lives in clear water at 3–40 metres (9.8–130 ft) of depth, mainly on coral colonies or sandy sea floor, feeding on coral polyps, various invertebrates and algae, but also on dead organic matter.

Subspecies and forms

References

  1. ^ Plouin, S.. ((2004)). Relation précoce avec le Picenum: une cyprée (Cypraea pantherina) de l’Océan indien dans une tombe aristocratique hallstattienne d’Alsace (Nordhouse, Bas-Rhin, France). Preistoria Alpina. ,v. 40 (Suppl. 1), pp. 101-106. ISSN 0393-0157
  2. ^ Gofas S & Zenetos A . (2003). Exotic Molluscs in the Mediterranean Basin: Current status and perspectives. In: Gibson R N & Atkinson R J A Oceanography and Marine Biology; An Annual Review Volume 41. London : Taylor & Francis. p.240 ISBN 0-203-23081-7 (PDF format) ISBN 0-415-25463-9 (print edition)
  3. ^ Gastropods.com : Cypraea pantherina pantherina; accessed : 21 October 2010
  4. ^ Gastropods.com : Cypraea pantherina pantherina albonitens; accessed : 21 October 2010
  5. ^ Gastropods.com : Cypraea pantherina pantherina catulus; accessed : 21 October 2010
  6. ^ Gastropods.com : Cypraea pantherina pantherina funebralis; accessed : 21 October 2010
  7. ^ : Cypraea pantherina pantherina nigrovinosa; accessed : 21 October 2010
  8. ^ Gastropods.com : Cypraea pantherina rasnasraniensis; accessed : 21 October 2010
  • Lorenz F. & Hubert A. - A guide to worldwide cowries. Edition 2. Hackenheim: Conchbooks. 584 pp
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!