Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 70 - 70
  Temperature range (°C): 25.857 - 25.857
  Nitrate (umol/L): 3.610 - 3.610
  Salinity (PPS): 34.451 - 34.451
  Oxygen (ml/l): 4.008 - 4.008
  Phosphate (umol/l): 0.392 - 0.392
  Silicate (umol/l): 4.097 - 4.097
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 38 - 38
  Temperature range (°C): 27.590 - 27.590
  Nitrate (umol/L): 0.954 - 0.954
  Salinity (PPS): 34.202 - 34.202
  Oxygen (ml/l): 4.381 - 4.381
  Phosphate (umol/l): 0.177 - 0.177
  Silicate (umol/l): 2.202 - 2.202
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erronea onyx

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCAGGTTTAGTTGGAACAGCCCTTAGTCTCTTAATTCGAGCAGAATTAGGTCAGCCAGGGGCTCTCCTAGGAGAC---GATCAATTATATAATGTAATTGTAACTGCTCATGCATTTGTTATAATTTTTTTCTTAGTTATACCTATAATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTGATGTTAGGAGCTCCAGACATAGCCTTTCCCCGTCTAAATAATATAAGTTTCTGGCTTCTACCTCCTGCTTTACTCCTTCTTCTTTCTTCGGCAGCAGTTGAAAGGGGGGTGGGTACTGGCTGGACTGTATATCCTCCTCTGGCAGGGAATCTTGCGCATGCAGGAGGATCTGTTGATCTTGCCATTTTTTCTCTCCATCTTGCTGGTGTTTCTTCTATTTTAGGTGCTGTGAATTTTATTACAACCATTATTAATATACGATGACGAGGAATACAATTTGAACGACTCCCCTTATTTGTTTGATCCGTAAAAATTACTGCTATTCTCCTCCTTCTCTCATTACCTGTATTAGCAGGGGCTATTACAATATTGTTAACGGACCGAAATTTTAACACCGCATTCTTTGATCCTGCTGGTGGTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erronea onyx

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Erronea onyx

Erronea onyx, common name the onyx cowry, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

Contents

Description

The shells of these quite common cowries reach on average 32–38 millimetres (1.3–1.5 in) of length, with a minimum size of 24 millimetres (0.94 in) and a maximum size of 57 millimetres (2.2 in). The dorsum surface of Erronea onyx is smooth, shiny and generally golden brown, with alternating longitudinal fuzzy bands of traslucent bluish and reddish colors (hence the Latin name onyx). The base and the margins are dark brown or black, sometimes the teeth are orange (especially in Erronea onyx adusta). In the living cowries mantle is dark brown, quite thin, with bluish papillae.

Shell of Erronea onyx
Shell of Erronea onyx adusta from Zanzibar
Dorsal view of three shells of Erronea onyx

Distribution

This species occurs the Indian Ocean on the coasts of Aldabra, the Comores, Kenya, Madagascar, Mauritius, Mozambique, Réunion, the Seychelles, Tanzania and in the Pacific Ocean along East China, Thailand, northern Australia, Indonesia, Philippines, Palau Islands and Solomon Islands.

Habitat

Erronea onyx lives in tropical and subtropical zones, in shallow subtidal water up to 5–25 metres (16–82 ft) depth, mainly in muddy areas or sandy sea floor, feeding on algae or coral polyps.

Subspecies

What used to be called Erronea onyx adusta, Lamarck, 1810 is now accepted as Erronea succincta adusta.

References

  1. ^ a b Erronea onyx (Linnaeus). WoRMS (2009). Erronea onyx (Linnaeus). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=216860 on 21 October 2010.
  • Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls.
  • Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!