Overview

Comprehensive Description

Summary

"Talparia talpa, commonly called the Mole Cowrie, is a marine gastropod found in the Red Sea and Indian Ocean."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Dorsum smooth and shiny, brown or yellow-brown in colour with 3-4 light brown transversal bands. Margins, base and teeth completely dark brown or black. Mantle well-developed, greyish or black, with long cylindrical papillae."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length range: 23 - 109 mm. Average length: 50 - 70 mm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Talparia talpa imperialis Schilder, F.A. & M. Schilder, 1938 Talparia talpa saturata (Dautzenberg, Ph., 1903)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

Marine: live in shallow coral reefs or shallow lagoons in tropical intertidal and subtidal waters up to 30 m depth. Found under ledges and in small coral caves at night.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 2 taxa.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 2 - 91
  Temperature range (°C): 25.015 - 28.496
  Nitrate (umol/L): 0.054 - 0.923
  Salinity (PPS): 33.721 - 35.037
  Oxygen (ml/l): 4.447 - 4.785
  Phosphate (umol/l): 0.071 - 0.222
  Silicate (umol/l): 0.983 - 2.543

Graphical representation

Depth range (m): 2 - 91

Temperature range (°C): 25.015 - 28.496

Nitrate (umol/L): 0.054 - 0.923

Salinity (PPS): 33.721 - 35.037

Oxygen (ml/l): 4.447 - 4.785

Phosphate (umol/l): 0.071 - 0.222

Silicate (umol/l): 0.983 - 2.543
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Rare.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Feed at dusk.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Talparia talpa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTATATGATCGGGTTTAGTTGGAACGGCCCTTAGTTTACTCATTCGTGCAGAGTTAGGTCAGCCAGGAGCTCTTTTAGGTGAT---GACCAATTATACAATGTAATTGTAACTGCTCATGCGTTTGTCATAATTTTCTTTTTAGTTATACCTATAATAATTGGTGGGTTTGGGAACTGATTAGTTCCTTTAATGTTAGGAGCTCCAGACATAGCTTTTCCACGTTTAAATAATATAAGTTTCTGGCTTCTGCCTCCTGCCTTACTCCTTCTTCTATCTTCAGCAGCTGTTGAAAGAGGAGTTGGAACAGGATGAACAGTTTATCCTCCTTTGGCAGGTAATCTTGCTCATGCTGGAGGTTCTGTTGATCTCGCCATCTTTTCATTGCACCTTGCTGGTGTTTCATCTATTTTAGGTGCTGTAAATTTCATTACAACCATTATTAATATACGATGACGAGGAATACAATTTGAACGACTACCTCTTTTTGTTTGATCAGTAAAGATTACTGCTGTTCTTCTTCTTCTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAACTTTAACACTGCCTTTTTTGACCCTGCTGGAGGAGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Talparia talpa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not Evaluated by IUCN Redlist.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

Listed in CITES: No. Listed in Wildlife (Protection) Act: Yes. Schedule: 1 Appendix: Part IV(B) Mollusca
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

"These cowries are used as currency, and in handbags, ornaments, belts, handicrafts etc."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Talparia talpa

Talparia talpa, common name the mole cowry or chocolate banded cowry, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

Distribution map of Talparia talpa

Contents

Subspecies

Description

The shells of these quite uncommon cowries reach on average 50–70 millimetres (2.0–2.8 in) of length, with a minimum size of 23 millimetres (0.91 in) and a maximum size of 105 millimetres (4.1 in). They are very variable in pattern and colour. The dorsum surface is smooth and shiny, the basic color is brown or yellowish brown, with three or four yellow or light brown transversal bands. The margins, the base and the teeth are completely dark brown or black. Also the teeth are dark brown, but the teeth spacing is clearer or white. In the living cowries mantle is greyish or black, with long cylindrical papillae. Mantle and foot are well developed, with external antennae. The lateral flaps of the mantle may hide completely the shell surface and may be quickly retracted into the shell.

Two shells of Talparia talpa, dorsal and apertural view
A shell of Talparia talpa, anterior end towards the bottom

Distribution

This species occurs in the Red Sea and in the Indian Ocean along East Africa (Aldabra, Chagos, the Comores, Eritrea, Kenya, Madagascar, the Mascarene Basin, Mauritius, Mozambique, Réunion, the Seychelles, Somalia and Tanzania), in the western Pacific (western Australia, Philippines), in Polynesia and Hawaii.

Habitat

These cowries live on coral reef or in shallow lagoons in tropical intertidal and subtidal waters up to 30 m depth. They can be found under ledges and in small coral caves at night, as they start feeding at dusk.

References

  1. ^ a b Talparia talpa (Linnaeus). WoRMS (2009). Talparia talpa (Linnaeus). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=216894 on 23 October 2010.
  2. ^ Gastropods.com : Talparia talpa imperialis; accessed : 23 october 2010
  3. ^ Gastropods.com : Talparia talpa saturata; accessed : 23 October 2010
  • Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls.
  • Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!