Overview

Comprehensive Description

Summary

"Leporicypraea mappa, commonly called Map Cowrie, is an economically important large marine gastropod found in the Indo-west Pacific. Its common name is derived from the resemblance of the distinctive colour pattern of its shells to ancient maps."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Shell globose with a near elliptical slightly elongate outline, narrow and relatively long aperture, arrays of small teeth on inner and outer lips, inflated dorsal side and slightly concave ventral side. Shell cream or white in colour, with many longitudinal lines and circular empty spaces. Dorsal mantle groove is devoid of lines. Both the ventral side of the shell and the labral teeth may vary greatly in color, ranging from white or cream, purple, brown, orange or pink."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 8-10cm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Subspecies Leporicypraea mappa admirabilis Lorenz, 2002 Subspecies Leporicypraea mappa aliwalensis Lorenz, 2002 Subspecies Leporicypraea mappa mappa (Linnaeus, 1758) Subspecies Leporicypraea mappa rosea (Gray, 1824) Subspecies Leporicypraea mappa viridis (Kenyon, 1902) Leporicypraea mappa rosea (Gray, 1824) Leporicypraea mappa panerythra (Melvill, 1888) Leporicypraea mappa viridis (Kenyon, 1902) Leporicypraea mappa geographica (Schilder & Schilder, 1933)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

General Habitat

"Marine: found in shallow coral reefs, under stone at depths of 45m."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leporicypraea mappa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGGTCAGGCTTGGTTGGGACAGCTTTAAGTCTTTTAATTCGAGCAGAATTAGGCCAACCAGGAGCTCTTTTAGGAGAT---GACCAGCTATATAATGTAATTGTAACAGCTCATGCATTTGTTATAATTTTCTTTCTAGTCATGCCTATAATAATTGGTGGATTCGGAAATTGACTTGTCCCCCTGATATTAGGAGCGCCAGATATAGCATTCCCTCGTTTAAATAACATGAGTTTTTGACTCCTGCCCCCAGCCCTATTATTGCTTCTTTCTTCAGCCGCTGTCGAAAGAGGAGTTGGAACGGGTTGAACGGTGTATCCCCCTTTGGCTGGGAATCTTGCGCACGCCGGAGGATCGGTTGATCTCGCTATTTTTTCTTTACACCTTGCTGGTGTGTCTTCCATTTTAGGTGCTGTAAATTTTATCACAACAATTATTAATATACGATGACGGGGCATACAATTCGAACGGCTCCCGTTATTTGTTTGATCCGTAAAGATCACTGCTATTCTTCTCCTTCTCTCGTTACCAGTCTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAATTTTAACACTGCTTTCTTTGACCCAGCAGGAGGTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leporicypraea mappa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not Evaluated by IUCN Redlist.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Legislation

Listed in CITES: No. Listed in Wildlife (Protection) Act: Yes. Schedule: 1 Appendix: Part IV(B) Mollusca
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

"Caught for human consumption, use in traditional medicine and linked with many superstitions. Shells were highly prized by private collectors till the 1950's and are now used as currency, ornaments and charms."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leporicypraea mappa

Leporicypraea mappa (previously known as Cypraea mappa), common name the map cowry, is a species of large sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

This is considered an economically important species in the Indo-West Pacific, where it is usually collected both for food and for shell trading.[3]

The map cowry was named on the basis of its distinct color pattern, because of the longitudinal lines and the easily distinguishable and sinuous mantle groove, which creates a resemblance to ancient maps.[3]

Contents

Taxonomy

Leporicypraea mappa was previously subordinated into the genus Cypraea. In the currently most accepted taxonomy of the Cypraeidae by Lorenz & Hubert (2000), this species is considered to be within the genus Leporicypraea, with several subspecies.[4] Recently, the division of this taxon in two or even three nominal species based on morphological and molecular characters has been suggested.[5]

Subspecies

Subspecies of Leporicypraea mappa include according to the World Register of Marine Species (WoRMS):[6]

The Indo-Pacific Molluscan also includes:[2]

Shell description

Dorsal view of a shell of the map cowry, Leporicypraea mappa. The anterior end is towards the bottom
Comparing the color pattern of the shell of Leporicypraea mappa (left) and an ancient Chinese topographic map (right)

The maximum shell length of this species is up to 10 cm, but it more commonly grows up to about 8 cm.[3]

The shell of Leporicypraea mappa is globose, with a near elliptical, slightly elongate outline. In affinity to other Cypraeidae, the aperture of the shell is very narrow, and relatively long. Both the inner and outer lips are ornamented with arrays of small teeth, though the teeth of the outer lip are shorter and stronger in comparison to the teeth of the inner lip, which are thinner and more numerous.[3] Its dorsal side is normally inflated, while the ventral side of the shell is slightly concave.

The shell is colored white or cream, with several longitudinal brown lines, which are sometimes interrupted by circular empy spaces. The cursory dorsal mantle groove line is dissimilar to the shells general color pattern, completely devoid of lines, thus easily perceivable. Its sinuous appearance, with several branches and notches, makes it a diagnostic character for this species. This exotic color pattern gives an appearance similar to that of ancient maps, hence the specific and common names. Both the ventral side of the shell and the labral teeth may vary greatly in color, assuming shades of white or cream, or even purple, brown, orange[3] or pink.[7]

Distribution

A map of the distribution of Leporicypraea mappa

Leporicypraea mappa is widely distributed in the Indo-Pacific. It is present in many regions, including East Africa, Madagascar, southeastern Red Sea, eastern Polynesia, southern Japan, Australia and New Caledonia.[3]

This exceptionally wide range may possibly be an artifact. Some conchologists claim that the taxonomy of the species is poorly resolved; if the map cowry is discovered to be cryptic species complex, then this could drastically change the range of its distribution.[8]

Ecology

Habitat

The map cowry lives in the intertidal and sublittoral zones, usually in coral reef areas, dwelling under slabs and stones at depths of 45 m.[3]

Human uses

The flesh of the map cowry is edible, and it is commonly collected by local fishermen for food and shell trading wherever it occurs. It is sold in fish markets in the northern Philippines.[3] The shells of Cypraea mappa (as it was previously known) were considered rare, exotic and beautiful, and were highly prized by private shell collectors in the late 1950s.[7]

References

  1. ^ (Latin) Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Editio decima, reformata. Holmiae. (Laurentii Salvii). 
  2. ^ a b ONIS Indo-Pacific Molluscan Database. retrieved 13 September 2010
  3. ^ a b c d e f g h Poutiers, J. M. (1998).Gastropods in: FAO Species Identification Guide for Fishery Purposes: The living marine resources of the Western Central Pacific Volume 1. Seaweeds, corals, bivalves and gastropods. Rome, FAO, 1998. page 492.
  4. ^ Lorenz, F.; Hubert, A. (2000). A Guide to Worldwide Cowries (2nd ed.). Hackenheim: CochBooks. ISBN 3-925919-25-2. 
  5. ^ Soriano, J. L. (2006). "Consideraciones taxonómicas sobre la familia Cypraeidae Rafinesque, 1815 (Mollusca: Caenogastropoda), con una nueva propuesta de clasificación supragenérica". Spira (in Spanish) (Associación Catalana de Malacologia) 2 (1): 41–62. 
  6. ^ WoRMS : Leporicypraea mappa; accessed 19 October 2010]
  7. ^ a b Chicago Natural History Museum Bulletin. Vol. 28, no. 4, April 1957. Page 3.
  8. ^ Lorenz, Felix (2002). "Revision of the mappas". Retrieved 2009-09-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Mauritia mappa

Mauritia mappa, common name the map cowrie, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

Contents

Description

Distribution

References

  1. ^ Mauritia mappa (Linnaeus, 1758). WoRMS (2009). Mauritia mappa (Linnaeus, 1758). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=216873 on 5 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!