Overview

Distribution

East Africa, Red Sea, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 30 specimens in 2 taxa.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0 - 70
  Temperature range (°C): 23.011 - 28.840
  Nitrate (umol/L): 0.048 - 2.040
  Salinity (PPS): 33.667 - 35.483
  Oxygen (ml/l): 4.349 - 4.754
  Phosphate (umol/l): 0.060 - 0.435
  Silicate (umol/l): 0.983 - 3.928

Graphical representation

Depth range (m): 0 - 70

Temperature range (°C): 23.011 - 28.840

Nitrate (umol/L): 0.048 - 2.040

Salinity (PPS): 33.667 - 35.483

Oxygen (ml/l): 4.349 - 4.754

Phosphate (umol/l): 0.060 - 0.435

Silicate (umol/l): 0.983 - 3.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monetaria moneta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCAGGACTAGTTGGTACAGCTCTTAGACTGTTAATTCGAGCAGAACTAGGTCAGCCCGGAGCTCTCTTAGGAGAT---GATCAACTATATAACGTAATTGTAACCGCCCATGCTTTTGTTATAATTTTCTTCCTAGTAATACCTATGATAATTGGGGGATTCGGAAACTGGCTGGTTCCCTTAATATTAGGAGCCCCAGACATAGCATTCCCTCGTTTAAATAATATAAGTTTCTGACTCCTCCCTCCTGCCCTGCTACTGCTCCTTTCTTCAGCCGCGGTTGAAAGCGGAGTCGGAACCGGATGGACCGTCTACCCTCCTTTAGCTGGAAACCTTGCCCACGCTGGTGGATCTGTAGATCTTGCCATCTTCTCCCTTCACTTAGCAGGTGTTTCGTCAATTTTAGGTGCTGTAAACTTTATTACAACTATTATTAATATACGGTGACGAGGTATACAGTTTGAACGACTTCCTTTGTTTGTATGATCCGTAAAAATCACCGCCATTCTCCTTCTTCTCTCTCTACCAGTTTTGGCCGGGGCCATTACAATGCTGCTGACAGATCGAAACTTTAATACTGCTTTCTTCGACCCGGCCGGAGGTGGAGACCCTATCTTATATCAACACTTGTTCTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monetaria moneta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Monetaria moneta

Monetaria moneta, common name the money cowry, is a species of small sea snail, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

This species is called "money cowry" because the shells were historically widely used in many Pacific and Indian Ocean countries as a form of exchange before coinage was in common usage.

Contents

Subspecies and forms

Subspecies:

Forms:

Distribution

A distribution map of Monetaria moneta

This is a very common species which is found widely in Indo-Pacific tropical waters. It is present in numerous regions, including East and South Africa, Madagascar, the Red Sea and the Persian Gulf, eastern Polynesia, Galapagos, Clipperton and Cocos[disambiguation needed] islands off Central America, southern Japan, Midway and Hawaii, and northern New South Wales and Lord Howe Island.[9]

Habitat

This cowry lives in intertidal rocky areas and shallow tide pools among sea weed, coral remains, and empty bivalve shells.[9] It can be found on and under rocks in shallow water and on exposed reefs at low tide. It feeds on algae and marine vegetation growing on loose rocks and pieces of dead coral.

Shell description

Dorsal view of two shells of Monetaria moneta

The shell is small (30 to 45 mm long[9]). It is white to straw-colored.

Human uses

The shell is used in jewelry and in other decorative items such as baskets and wall hangings.

As money

Shells of this cowry were commonly used as a medium of exchange[9] in many areas of Africa, Asia and the Pacific islands until the late 19th century.

The Maldives provided the main source of cowrie shells, throughout Asia and parts of the East African coast. Huge amounts of Maldivian cowries were introduced into Africa by western nations during the period of slave trade.[10]

It was also traded to Native Americans by European settlers.

For divination

The shell is still used in divination rituals by some African animist tribes.[9]

In the State of Kerala, in India, special money cowry shells (which are known in Malayalam as Kavidi കവിടി) are used for divination as part of Hindu astrology, as Prashnam. For Prashnam, 108 shells of Monetaria moneta are rotated a number of times and the blessings of God and one's Guru are invoked. A portion of the Kavadis are separated and counted to find out the ruling planet at that time. The results of the Prasna horoscope (a horoscope formulated at the time of arrival of the persons) are compared with the results of the Prasnam, and the predictions are pronounced on that basis.

References

  1. ^ a b WoRMS : Monetaria moneta; accessed : October 20, 2010
  2. ^ Gastropods.com : Monetaria moneta; accessed : 20 October 2010
  3. ^ Gastropods.com : Monetaria moneta barthelemyi; accessed : October 20, 2010
  4. ^ Gastropods.com : Monetaria moneta erosaformis; assessed : October 20, 2010
  5. ^ Gastropods.com : Monetaria moneta harrisi; accessed : October 20, 2010
  6. ^ gastropods.com : Monetaria moneta icterina; accessed : October 20, 2010
  7. ^ Gastropods.com : Monetaria moneta rhomboides; accessed : October 20, 2010
  8. ^ Gastropods.com : Monetaria moneta tuberculosa; accessed : October 20, 2010
  9. ^ a b c d e Poutiers, J. M. (1998). Gastropods in: FAO Species Identification Guide for Fishery Purposes: The living marine resources of the Western Central Pacific Volume 1. Seaweeds, corals, bivalves and gastropods. Rome, FAO, 1998. page 503.
  10. ^ Hogendorn, Jan and Johnson Marion: The Shell Money of the Slave Trade. African Studies Series 49, Cambridge University Press, Cambridge, 1986.
  • Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!