Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 4

Graphical representation

Depth range (m): 2 - 4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melicerona felina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCGGGCTTAGTTGGAACAGCCCTTAGCCTACTAATTCGAGCAGAATTAGGTCAGCCGGGAGCTCTCTTGGGGGAC---GATCAGCTGTATAATGTAATTGTAACTGCTCATGCATTTGTTATAATTTTCTTTTTAGTTATACCTATAATAATTGGAGGATTTGGAAATTGGTTAGTTCCTTTGATATTAGGGGCTCCAGATATAGCTTTCCCTCGTTTAAATAATATAAGTTTCTGGCTTTTACCTCCTGCTCTTCTTCTTCTTCTTTCTTCAGCAGCAGTTGAAAGAGGGGTTGGAACTGGATGAACAGTATATCCTCCTTTAGCAGGAAATCTTGCACATGCAGGGGGATCTGTTGATCTTGCTATTTTTTCGTTGCATCTTGCTGGTGTTTCTTCTATTTTAGGTGCTGTAAATTTTATTACAACTATTATCAATATACGATGACGAGGAATACAGTTTGAGCGACTTCCATTATTTGTGTGATCTGTAAAGATTACTGCCATCCTTCTACTTCTTTCATTGCCTGTATTAGCAGGGGCTATTACGATGCTATTAACGGATCGAAATTTTAATACTGCTTTCTTTGACCCTGCAGGAGGTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melicerona felina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Melicerona felina

Melicerona felina, common name the kitten cowrie, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

Contents

Description

Melicerona felina has a shell reaching a size of 10-30 mm. Dorsum has a somewhat banded and spotted pattern with a yellow-brown coloration. It lives under coral slabs on leeward intertidal reefs, at a depth of 2-4 m.

Distribution

This species is distributed in the Red Sea and in the Indian Ocean along Aldabra, Chagos, the Comores, the East Coast of South Africa, Kenya, Madagascar, the Mascarene Basin, Mauritius, Mozambique, Réunion, the Seychelles, Somalia and Tanzania.

References

  1. ^ a b Melicerona felina (Gmelin, 1791).  Retrieved through: World Register of Marine Species.
  • Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls
  • Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey
  • Branch, G.M. et al. (2002). Two Oceans. 5th impression. David Philip, Cape Town & Johannesburg
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!